var textForPages = ["Sborník příspěvků                                                                                          Brno 3.–4. 6. 2014","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                                 Všechna práva vyhrazena. Žádná část této elektronické knihy nesmí                                         být reprodukována nebo šířena v papírové, elektronické či jiné podobě                                          bez předchozího písemného souhlasu vykonavatele majetkových práv                                         k dílu, kterého je možno kontaktovat na adrese – Nakladatelství                                          Masarykovy univerzity, Žerotínovo náměstí 9, 601 77 Brno.                                                                              2","XIV. Pracovní setkání                            fyzikálních chemiků a elektrochemiků                       th                14  Workshop of Physical Chemists and Electrochemists                                   Sborník příspěvků                                                       3.–4. 6. 2014                                                         Masarykova univerzita                                                         Brno 2014","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Organizace pořádající konferenci                 Přírodovědecká fakulta Masarykovy univerzity v Brně                 Ústav chemie                 Kotlářská 2                611 37 Brno                 http://www.sci.muni.cz                 Agronomická fakulta Mendelovy univerzity v Brně                Ústav chemie a biochemie                 Zemědělská 1                613 00 Brno                 http://ucb.af.mendelu.cz                 Fakulta elektrotechniky a komunikačních technologií Vysokého učení technického v Brně                 Ústav mikroelektroniky                Technická 3058/10                 616 00 Brno                http://www.umel.feec.vutbr.cz                   Organizační zabezpečení konference                 Libuše Trnková                libuse@chemi.muni.cz (Ústav chemie, PřF, MU)                 René Kizek                 kizek@sci.muni.cz (Ústav chemie a biochemie, AF, MENDELU)                Jaromír Hubálek                 hubalek@feec.vutbr.cz (Ústav mikroelektroniky, FEKT, VUT v Brně)                  Publikace neprošla jazykovou kontrolou. Jednotlivé příspěvky jsou publikovány tak, jak byly                 dodány  autory.  Za  věcnou  a  odbornou  správnost  jsou  plně  odpovědni  autoři  příspěvků.                Podrobné  informace  včetně  sborníku  příspěvků  jsou  k dispozici  na  internetové  adrese                 http://sci.muni.cz/~labifel/                   © 2014 Masarykova univerzita                ISBN 978-80-210-6842-1                                                                2","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      Pracovní setkání bylo podpořeno výzkumnými organizacemi a projekty :                                                                                                                                 3","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                    Sponzoři pracovního setkání                 Organizátoři  děkují  všem  letošním  sponzorům  za  podporu,  která  umožnila  pořádat  tuto  již                 tradiční akci: Metrohm Česká Republika s.r.o.,  Eppendorf Czech \& Slovakia s.r.o., Sigma -                Aldrich  spol.  s r.o.,  LABMARK  a.s.,  Chromservis  s.r.o., VWR  International  s.r.o.,  Biotech                 a.s., Pragolab s.r.o , Česká společnost chemická, pobočka Brno                                                                 Hlavní sponzor                                                                                                                4","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Milí přátelé,                        vítáme  Vás  na  dalším,  již  čtrnáctém  ročníku  Pracovního  setkání                                                                th                fyzikálních chemiků a elektrochemiků (14  Workshop of Physical Chemists and                Electrochemists). Letošní konference se koná v nových prostorách Masarykovy                univerzity (MU) a  my věříme, že se Vám v  Univerzitním kampusu Bohunice                (UKB)  bude  líbit.  Na  organizaci  celé  akce  se  podílejí  významné  brněnské                vysoké  školy – MU, MENDELU a VUT, které jsou zapojeny do centra vědecké                excelence  v  oblasti  věd  o  živé  přírodě,  pokročilých  materiálů  a  technologií                (CEITEC:  Central  European  Institute  of  Technology  –  středoevropský                technologický institut). Konáním naší konference bychom chtěli:                    a)  ukázat, že k rozvoji vědy přispívá zintenzivnění mezioborové spolupráce,                       tedy úzké propojení vědeckého výzkumu v oblasti živé a neživé přírody,                    b) oslavit 95. výročí od založení dvou univerzit – MU a MENDELU,                    c)  připomenout  si  55.  výročí  udělení  Nobelovy  ceny  za  fyzikální  chemii                       prof. Jaroslavu Heyrovskému za objev polarografie a také                    d) poskytnout  mladým  a  nadějným  vědcům  příležitost  prezentovat  svoje                       výsledky, diskutovat o nich a získat informace, které jim pomohou se dál                       vědecky rozvíjet.                    Záštitu nad XIV. Pracovním setkáním fyzikálních chemiků a elektrochemiků                přijali  rektor  Masarykovy  univerzity  doc.  PhDr.  Mikuláš  Bek,  Ph.D.,  rektor                Mendelovy  univerzity  prof.  RNDr.  Ladislav  Havel,  CSc.,  a  rektor  Vysokého                učení  technického  v Brně  prof.  RNDr.  Ing.  Petr  Štěpánek,  CSc.  Na  úrovni                děkanů  se  záštity  ujali  doc.  RNDr.  Jaromír  Leichmann,  Dr.  (Přírodovědecká                fakulta MU), doc. Ing. Pavel Ryant, Ph.D. (Agronomická fakulta MENDELU)                a  prof.  Ing.  Jarmila  Dědková,  CSc.  (FEKT  VUT).  Za  technologický  institut                záštitu  převzal  i  prof.  Ing.  Radimír  Vrba,  CSc.,  vědecký  ředitel  pro  oblast                pokročilých materiálů a nanotechnologií CEITEC.                       Konference, jako každým rokem, bude jistě plná zajímavých příspěvků ve                formě plenárních (6) a zvaných přednášek (7) a také posterových sdělení (38),                ale  hlavní  pozornost  bude  věnována  mladým  vědcům  a  studentům,  kteří  se                zúčastní  soutěže  v  Sekci  mladých  (SM).  Stalo  se  už  zvykem,  že  studenti                magisterského,  doktorského,  ale  i  bakalářského  studia  prezentují  v SM                v anglickém  jazyce  své  příspěvky  a  jejich  vystoupení  je  hodnoceno  odbornou                komisí  po  stránce  obsahové  i  formální.  Nejlepší  studenti  jsou  pak  finančně  i                věcně oceněni. Podobně probíhá soutěž o nejlepší plakátové (posterové) sdělení,                které autor uvede s krátkou prezentací. Každý autor má možnost rozhodnout se,                zda se této soutěže chce zúčastnit.                       Rozšířená  abstrakta  v anglickém  jazyce  od  všech  účastníků  konference                jsou  zpracována  do  sborníku  s přiděleným  ISBN,  čímž  sborník  odpovídá                kritériím pro hodnocení V a V v kategorii „Článek ve sborníku“.                       Děkujeme  všem  firmám,  které  podporují  Pracovní  setkání  fyzikálních                chemiků a navazující Letní elektrochemickou školu. Děkujeme spolupořadateli                                                               5","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Letní  elektrochemické  školy,  firmě  METROHM  Česká  republika  s.r.o.                Poděkování  patří  i  České  společnosti  chemické  za  příspěvek  na  knižní  ceny                vítězným studentům.                       Všechny účastníky na půdě Masarykovy univerzity v nových prostorách                kampusu  vítáme  a  přejeme  jim  úspěšnou  prezentaci,  která  spolu  s bohatou                diskuzí může být další inspirací v jejich krásné činnosti – vědeckém bádání.                                                             \"V  čem  spočívá  tvůrčí  proces  ve  vědě? Ve  schopnosti                 poznat, co je důležité a co podružné.\"                                                                                                Jaroslav Heyrovský                                                                              6","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      Obsah                 Investigation of the carbon material based electrodes for supercapacitors                 9                The  effect  of  ochratoxin A  on  DNA  adduct  formation  by  the  carcinogen  aristolochic                acid in rats                                                                             12                Role of rat cytochromes p450 in oxidation of 17α-ethinylestradiol                        15                Structure  and  spectroscopic  characterization  of  copper(II)  complexes  with                fluoroquinolones                                                                         18                NAD(P)H:quinone  oxidoreductase  1  is  Induced  by  3-nitrobenzanthrone,  aristolochic                acid, ellipticine, Sudan I and dicoumarol in rats - a comparative study                  20                Study  of  structure  and  chemical  composition  of  soil  humic  substances  isolated  from                Humic Podzol                                                                             23                Effect of bitumen on sorption properties of lignite                                      28                Piezoelectric biosensors for detection of microorganisms                                 32                Hight  performance  sulfur  nanocomposites  as  cathode  materials  based  on  conversion                reaction                                                                                 26                Physicochemical methods as a suitable instrument for short DNA fragments study           40                Studium fotochemických chránících skupin pomocí časově rozlišené spektroskopie. Je                nano sekunda málo nebo moc pro roztržení vazby?                                          43                Hyaluronana micro- and nanoparticles                                                     44                Mircorheological characterization of hyaluronic acid gels                                47                Development  of  the  cell  systém  for  evaluation  of  ANTI-PAIIL  immmunoglobulin                efficacy                                                                                 51                Cytochrome  p450  1A1-catalyzed  oxidation  of  carcinogenic  benzo[a]pyrene  is                modulated by NADH and cytochrome b 5                                                     54                The azobenzene actinometer                                                               57                Deeper  Research  of  Structural  Changes  of  Humic  Acids  Using  Light  Scattering                Techniques                                                                               59                Are flavonoids fenoxide anions better hydrogen atom donors than parent molecules?        64                On the homolytic and heterolytic O–H bond cleavage in vitamin b6                         67                Observation  of  prompt  ISC  from  higher  excited  states  of  the  anion  of  p-                hydroxyacetophenone                                                                      70                Acidity  of  Frozen  Solutions  and  Its  Connection  to  Degradation  of  Enzymes  upon                Freezing                                                                                 71                Study of nanoparticles formed by negatively charged hyaluroan and cationic surfactant    73                Application  of  CdTe-Quantum  dots  nanoparticles  for  luminiscence  determinativ  of                metal ions                                                                               78                Nanosecond laser flash photolysis Study of rose Bengal                                   81                EPR-UV/Vis/NIR SpectroElectrochemical studies of substituted diarylaminothiophenes       82                EPR-UV/Vis/NIR SpectroElectrochemistry of thienyl derivatives of pyrene                  85                How to measure quantitative EPR spectra reproducibly                                     88                Utilization  of  fluorescence  spectroscopy  for  studying  of  the  interactions  in  dried                systems of biopolymer and hydrophobic species                                            91                Determination of organic acids in wine using by biosensors                               95                New  Kinetic  Models  in  Biopolymer  Degradation:  Long  Term  Study  of  Hyaluronan                Samples                                                                                  99                Oxidation  of and DNA  adduct  formation  by benzo[a]pyrene by rat  cytochrome  p450                1A1 are stimulated by cytochrome b 5 and NADH                                          103                                                                7","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Aryl  hydrocarbon  receptor  ligands  benzo[a]pyrene,  ellipticine  and  Sudan  I  induce                expression  of  cytochrome  p450  1A1,  NAD(P)H:quinone  oxidoreductase  1  and                cytochrome b 5                                                                         107                Determination of methylxantines on pencil graphite electrodes by cyclic voltammetry    111                Trends in development of functional nanostructured films                               114                Biodegradable materials for orthopedic applications                                    118                An  Electrochemical  study  of  d(GCGAAGC)  DNA  heptamer  and  its  sequential                analogues                                                                              121                Aromatase  (Cytochrome  p450  19)  is  an  efficient  enzyme  activating  anticancer  drug                ellipticine                                                                            124                DFT and NMR studies of  PPD antioxidants                                               128                Computational Insight to the Themodynamics of Double H atom abstraction in model                phenolics                                                                              131                On radical anion generation upon hydrogen atom transfer in dihydroxybenzenes           134                Methylation  of  Humic  acids  –  the  Impact  on  the  Reactivity  Studied  by  Diffusion                Techniques                                                                             137                Electrochemical sensor for carbonate determination                                     142                Formation of DNA adducts by ellipticine and its micellar form in Rats – a Comparative                Study                                                                                  145                The site directed mutagenesis of key aminoacids in the heme distal side of an oxygen                sensor,  YddV,  probably  converts  its  character  from  a  O 2  sensing  protein  to  a  heme                oxygenase enzyme                                                                       148                Inhibitors of cyclin-dependent kinases as new generation of anticancer drugs           151                Effect  of  deep  freezing  to  quality  of  HEK293  Transfected  with  CaV  3.1  membrane                channel                                                                                153                Fluorescence study of mixed micelles formation                                         156                Interaction of heavy metals with graphene and iron based particles                     160                FIA-ED: optimization of method for electrochemical study of doxorubicin                163                Flow  injection  analysis  with  electrochemical  detection  for  rapid  identification  of                platinum-based cytostatics and platinum chlorides in water                             166                Electrophoretic behavior of doxorubicin                                                169                Utilization of Electrochemistry for detection of bacteria on a 3D printed flow chip    173                Liposomal  Transporter  with  GFP  mark  for  Targeted  Binding  using  a  Nucleic  Acid                Anchor System                                                                          176                Interaction  study  of  arsenic(III)  ions  with  metallothionein  gene  (MT2a)  fragment                assessed by spectrometry and electrochemistry                                          179                Automatic Electrochemical determination of heavy metals and application to a remote-                controlled robotic platform orpheus-hope                                               182                Microrna electrochemical detection in connection with specific magnetic separation     185                Interaction of metallothionein with CdTe quantum dots studied by electrochemistry      189                Physical chemistry of inorganic-organic nanostructures                                 192                Elimination square wave voltammetry                                                    194                Device for dehydration monitoring using potassium concentration in urine measurement  197                Semiconductive SnO 2/MWCNTs  gas sensor                                                200                Hight resolution technics for fabrication of special nanoelectrodes                    203                                                                    8","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                             INVESTIGATION OF THE CARBON MATERIAL BASED                                    ELECTRODES FOR SUPERCAPACITORS                                          1,2                                                                    2*                                                                                                 2                         Stepan I. YUSIN , Alexander G. BANNOV , Anastasia A. TIMOFEEVA ,                                                                                      2                                                            2                                    Maria A. NEMZOROVA , Ksenya V. TIKHONINA                1                       Institute  of  Solid  State  Chemistry  and  Mechanochemistry  of  the  Siberian  Branch  of  the  Russian                Academy of Sciences, Kutateladze 18, 630098 Novosibirsk, Russian Federation                2                       Department of Chemistry and Chemical Technology, Faculty of Mechanics and Technology, K. Marx 20,                630 073 Novosibirsk, Russian Federation                *bannov.alexander@gmail.com                Abstract                 In  this  work  the  different  types  carbon  materials,  such  as  carbon  fibers,  graphite  oxide,                exfoliated graphite were studied  for the using as  an electrode materials in  supercapacitors.                 The capacitance of the supercapacitors depends on the surface area of the electrode material,                therefore using of the carbon materials with high surface area is more effective.                  1. INTRODUCTION                 Carbon materials find their application as electrode materials or electro-conductive additives                 in supercapacitors and electrodes of electrochemical power source. In this work carbon fibers,                graphite oxide, exfoliated graphite were used as main part of electrodes for supercapacitors [1,                 2]. But the capacitance of the supercapacitors based on untreated carbon materials can be very                 low;  therefore,  this  characteristic  can  be  increased  by  the  using  of  different  treatment                techniques. The aim of this work is the investigation of different types of carbon materials for                 their using as electrode materials in supercapacitors.                  2. MATERIAL AND METHODS                 Graphite oxide was synthesized from high-quality graphite by the different modification of                 Hummers method [3]. Exfoliated graphite was synthesized from graphite oxide. Also carbon                fibers  and  carbon  fiber  composite  electrodes  were  investigated.  The  composite  electrodes                 based  on  a  carbon  fibers  were  prepared  by  following  technique:  the  particles  of  metal,                oxygen-containing, compounds were deposited from solutions on the Activated Carbon Fiber                 Material  (ACFM)  brand  “UVIS-AK-V-240”  (Russia)  by  electrophoresis  in  a  controlled                conditions  [4].  The  electrophoresis  was  carried  out  in  0,01  M  colloidal  solution  with  the                 particles  of  metals  oxides  and  metal  hydroxides.  The  colloidal  solution  passed  through                                                                                                        2                ACFM. The electrophoresis was performed in the constant current density of 150 А/m  by                                                             9","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  anodic. After the electrophoresis the ACFM was carefully washed out by distilled water, dried                          o                up at 200  С and then electrical capacitance was studied.                The carbon materials were suggested of use as the electrodes, therefore it were investigated by                 the value of electrical capacitance (C el). Voltammetric curves were obtained using Elins P-                 30SM  analyzer  (Russia)  in  accordance  with  a  three  electrode  scheme.  All  electrodes  were                placed into the electrolyte of a 3.5 M H 2SO 4 solution.                   3. RESULTS AND DISCUSSION                 The  results  of  the  capacitance  measurements  of  electrodes  based  on  carbon  fibers,  carbon                 fiber  composites,  graphite  oxide  and  exfoliated  graphite  are  presented  in  Table  1.  The                composite  electrodes  carbon  fiber–Ni(OH) 2  and  –Co(OH) 2  that  were  prepared  by                 electrophoresis, possessed higher capacitance values: maximum value that were obtained on                composite material “ACFM-Ni(OН) 2” is 377 F/g – the 7 times higher as compared with initial                 ACFM fibers. The decreasing of potential scan rate induces the increasing of the capacitance.                 The electrical capacitance at different scanning rate depends significantly on the formation of                electric double layer [5].                  Table 1: Comparison of the different types of carbon material electrodes.                                               C el (F/g) recorded at various of   Average                     Electrode material         potential scan rate, mV/s      flow    Deposition   Weight                                                                                                     gain ω                                                                                        weight, g                                                                             rate, ml/s                                                 2          5        10                        ACFM  initial           52         39        30         -           -          -                      ACFM -MnO 2               176        100       42       0,010       0,012      50%                     ACFM -Co(OН) 2             322        210       120      0,012       0,010      46%                      ACFM -Ni(OН) 2             377        252       123      0,017       0,007      30%                     Graphite oxide #1          21         18         8         -           -          -                     Graphite oxide #2          68         40        19         -           -          -                   Exfoliated graphite #1       101        71        32                    (obtained from GO)                                          -           -          -                 Figure 1a shows that the electrophoretic particles precipitate firmly adhered to the fibers or                 envelops. The exfoliated graphite sample possessed lower surface as compared with carbon                fibers,  but  this  material  was  predominantly  mesoporous  and  obtained  101  F/g  capacitance                 (Figure 1b).                                                                  10","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                 a                                                                                             b                              Figure 1.: SEM micrographs of \"ACFM - MnO 2 “ (a) and exfoliated graphite (b) samples                  One of the components for synthesis of graphite oxide – KMnO 4, therefore using of certain                 reagents amounts will provide the formation of MnO 2 on the surface of graphite oxide. The                exfoliated graphite possessed higher capacitance due to formation of manganese oxide on the                 porous surface of the material. Therefore the capacitance of the exfoliated graphite was higher                than that of for GO. The exfoliation of the graphite oxide tends to the formation of the highly                 porous material  due to  the rapid  exhausting of the gases produced from  surface functional                 groups.                  4. CONCLUSION                The  results  obtained  shows  that  the  carbon  materials  with  high  surface  possess  high                 capacitance and can be used as electrode materials for supercapacitors. The capacitance can                 be increased by using of different types of modifications which modify the textural properties                of the material and amplify the pseudocapacitance effects.                  5. ACKNOWLEDGEMENT                 The work has been supported by the Strategic Development Programme NSTU (project 3.1.2                Implemention of projects by young scientists, the project S-35).                   6. REFERENCES                [1]    Bannov A, Timofeeva A, Shinkarev V, et all.: Protection of Metals and Physical Chemistry of Surfaces,                                50 (2014), 2, 183-190                [2]    Jung I, Pelton M, Piner R: Nano Lett., 7 (2007), 12, 3569-3575                [3]    Hummers W, Offeman R: J. Am. Chem. Soc., 80 (1958), 1339-1339                [4]    Uvarov N, Mateyshina Yu, Ulihin A, et all.: ECS Transactions, 25 (2010),  21, 11-16                [5]    Artem’yanov A, Sheveleva I: Russian Journal of Applied Chemistry, 7 (2004), 11, 1811-1814                                                                11","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                    THE EFFECT OF OCHRATOXIN A ON DNA ADDUCT FORMATION                          BY THE CARCINOGEN ARISTOLOCHIC ACID IN RATS                                                                                                         2                                                                              1                                                                                             1                                     1*                                                         1                 Marie STIBOROVA , Frantisek BARTA , Katerina LEVOVA , Petr HODEK , Eva FREI ,                                                               3                                                                                  4                                         Heinz H. SCHMEISER , Volker M. ARLT                1                   Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, 128 40                   Prague 2, Czech Republic                2                   Division  of  Preventive  Oncology,  National  Center  for Tumor  Diseases,  German  Cancer                   Research Center (DKFZ), In Neuenheimer Feld 280, 69 120 Heidelberg, Germany                3  Division  of  Radiopharmaceutical  Chemistry  (E030),,  German  Cancer  Research  Center                    (DKFZ), In Neuenheimer Feld 280, 69120 Heidelberg, Germany                4                   Analytical and Environmental Sciences Division, MRC-PHE Centre for Environment and                    Health, King’s College London, London, United Kingdom                   *stiborov@natur.cuni.cz                Abstract                 Exposure  to  the  natural  plant  extract  aristolochic  acid  (AA)  leads  to  the  development  of                aristolochic  acid  nephropathy  (AAN),  Balkan  endemic  nephropathy  (BEN)  and  urothelial                 cancer  in  humans.  Beside AA,  exposure  to  the  mycotoxin  ochratoxin A  (OTA)  potentially                 contributes to the development of BEN. Therefore, we studied the influence of OTA on the                genotoxicity of AA in vivo. DNA adduct formation was analyzed in liver and kidney of rats                                                                           32                treated with AA, OTA or AA combined with OTA using the  P-postlabelling method.                1. INTRODUCTION                Balkan Endemic nephropathy (BEN) is a chronic tubulointerstitial nephropathy characterized                 by  an  insidious  onset  and  gradual  progression  to  end-stage  renal  disease,  which  was  first                described more than 60 years ago. A charateristic feature of BEN is its close association with                 upper urothelial carcinomas (UUC) of the renal pelvis and ureter. For the past decades the                majority of this research focused on various heavy metals, mycotoxins such as ochratoxin A                 (OTA)  and  organic  chemicals  until  recently  when  the  carcinogenic  and  nephrotoxic  plant                 product aristolochic acid (AA) was identified as the main cause for the development of BEN-                associated UUCs [1-5]. Nevertheless a role of the nephrotoxin OTA in the development of                 BEN cannot be ruled out, even though exposure to OTA was rejected as an important factor                for  BEN/UUC  by  the  EU  Committee  on  Food  Safety  [6].  BEN  is  very  similar  to  another                 nephropathy, aristolochic acid nephropathy (AAN), which has been unambiguously proven to                be caused by AA exposure [2,5,7,8]. In this study we investigated influence of OTA on the                                                               12","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    genotoxicity of the plant extract AA, a natural mixture of 8-methoxy-6-nitro-phenanthro-(3,4-                 d)-1,3-dioxolo-5-carboxylic acid (AAI, Fig. 1) and 6-nitro-phenanthro-(3,4-d)-1,3-dioxolo-5-                carboxylic acid (AAII) in Wistar rats in vivo.                 2. MATERIAL AND METHODS                Rats were either treated separately with AA and OTA or with AA in combination with OTA,                 namely, i.p. daily for 5 consecutive days with (i) a dose of 10 mg/kg body weight (bw) of the                natural plant extract AA, (ii) a dose of 2 mg/kg bw OTA and with (iii) both AA and OTA at                 doses mentioned above. DNA of rat liver and kidney were analyzed for the presence of AA-                                                                                    32                DNA  adducts  [2,7-9]  and  OTA-related  DNA  adducts  [10,11]  by  P-postlabeling.  DNA                adduct  levels  (RAL,  relative  adduct  labelling)  were  calculated  as  described  [9].  AA-DNA                 adducts  were  identified  using  reference  standards  as  described  [9].  For  OTA-related  DNA                adducts kidney DNA from OTA-treated Wistar rat [10,11] served as reference.                 3. RESULTS  AND  DISCUSSION                                                                                                       32                Formation  of  AA-DNA  adducts  and  OTA-related  DNA  adducts  was  determined  by  P-                postlabeling in liver and kidney of rats treated with a total i.p. dose of 50 mg /kg bw of the                 plant extract AA (natural mixture of AAI and AAII), with a total i.p. dose of 10 mg/kg bw of                OTA, and with both these agents together. It is noteworthy that modifications to the nuclease                               32                P1 version of  P-postlabelling assay were made in order to detect and quantify the AA-DNA                adducts [8, 9] and OTA-related DNA adducts [10,11], respectively.                              32                    Using the  P-postlabeling assay routinely used for the detection of AA-DNA adducts, all                liver and kidney samples from Wistar rats treated with AA showed an adduct pattern similar to                that  found  in  kidney  tissue  from  BEN  and  AAN  patients  [7,8,12].  The  adduct  pattern                 consisted of three major adduct spots. Two of them have been identified as 7-(deoxyadenosin-                  6                                                                      6                N -yl)aristolactam I (dA-AAI) and 7-(deoxyadenosin-N -yl)aristolactam II (dA-AAII). It has                been shown previously that the dA-AAII adduct can be generated from AAI and is probably                 formed via a demethoxylation reaction of AAI or dA-AAI [8]). Another adduct was identified                                                                                                         2                                         2                as  7-(deoxyguanosin-N -yl)aristolactam  I  (dG-AAI)  whereas  7-deoxyguanosin-N -                yl)aristolactam  II  (dG-AAII)  was  not  detectable.  The  dG-AAII  adduct  has  been  found                previously at a low but detectable levels in DNA of rats treated with AAII in vivo or in ex vivo                 and  in  vitro  experimental  systems  [8,9].  Therefore,  deoxyadenosine  is  the  major  target  of                DNA modification by AA, pointing to the general importance of the dA-AAI and dA-AAII in                 the carcinogenic process of AA. In contrast, no adducts were found in DNA of control rats                 treated with vehicle only.                                                               13","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                      When samples were chromatographed under conditions suitable for the detection of OTA-                 related adducts [10,11], all three purine AA-DNA adducts were also well separated and none                of the AA-DNA adducts migrated in the area of the thin-layer chromatography plate where                 OTA-related DNA adduct spots would be located. The levels of AA-DNA adducts determined                                                                  32                by this method were similar to those found by the  P-postlabeling version routinely used for                the detection AA-DNA. However, in contrast, no OTA-related DNA adducts were detectable                in rats treated with OTA alone. Likewise, no OTA-related DNA adducts were found in liver                 and kidney of rats treated with AA together with OTA whereas AA-DNA adducts were clearly                 detectable in these samples and identified as described above.                    Generally, in all rats AA-DNA adduct levels were higher in kidney, the target organ of AA                 genotoxicity, than in liver. In both organs the levels of AA-DNA adducts increased when AA                treatment  was  combined with  the OTA exposure. Compared to adduct levels  found in  rats                 treated  with  AA  alone,  DNA  binding  was  5.4-  and  1.6-fold  higher  in  liver  and  kidney,                respectively, than in rats treated with both AA and OTA. Therefore, OTA, when administered                 to rats with AA, induces pathways which lead to a higher bioactivation of AA in both organs.                 4. CONCLUSION                The results are the first findings strongly suggesting a potency of OTA when administrated                 together with AA during exposure to contribute to the BEN/UUC development.                 5. ACKNOWLEDGEMENT                The work has been supported by GACR (P303/10/G163) and Charles University (grant 570513).                6. REFERENCES                 [1]  Arlt V.M., Ferluga D., Stiborova, M. et al.: International Journa of Cancer, 101 (2002) 500-502.                [2]  Arlt VM, Stiborova M, vom Brocke J, et al.: Carcinogenesis 28 (2007), 2253-2261                [3]  Grollman  A.P., Shibutani S., Moriya M., et al.: Proceedings of  American Chemical Society U.S.A., 104                    (2007), 12129-12134                [4]  Jelaković B, Karanović S, Vuković-Lela I, et al.: Kidney International, 81 (2012) 559-567.                [5]  Gökmen M.R., Cosyns J.P., Arlt, V.M. et al.: Annals of Internal Medicine, 158 (2013) 469-477.                [6]  EFSA: EFSA Journal, 365 (2006) 1-56.                [7]  Nortier J.L., Martinez M.C., Schmeiser H.H., et al.: New England Journal of Medicine, 342, (2000 1686-                    1692.                [8]  Arlt V.M., Stiborova M., Schmeiser, H.H.: Mutagenesis, 17 (2002)  265-277.                [9]  Schmeiser HH, Stiborova M, Arlt VM: Current Opinion in Drug Discovery and Development, 12 (2009),                    141-148                [10] Pfohl-Leszkowicz A., Grosse Y., Castegnaro M., et al.: IARC Science Publications 124 (1993) 141 -148.                [11] Arlt VM, Pfohl-Leszkowicz A, Cosyns J, et al.: Mutation Research, 494 (2001) 143-150.                [12] Schmeiser HH, Kucab JE, Arlt VM,, et al.: Environmental and Molecular Mutagenenesis, 53 ( 2012) 636-                    641.                                                                 14","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                               ROLE OF RAT CYTOCHROMES P450 IN OXIDATION OF 17α-                                                  ETHINYLESTRADIOL                  Lucie BOREK-DOHALSKA, Petra VALASKOVA, Vera CERNA and Marie STIBOROVA                 Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030,  128 40 Prague 2, Czech                Republic                  Abstract                       17α-ethinylestradiol  (EE2)  is  an  endocrine  disruptor  that  is  a  key  active  ingredient                 used in a variety of oral contraceptives. The objective of the present study was to determine a                 role  of  individual  rat  CYP  enzymes  in  EE2  oxidation.  The  contribution  of  CYPs  in  EE2                hydroxylation was investigated using specific inhibitors and/or inducers of individual CYPs.                 Moreover,  the  heterologous  baculovirus  expression  systems  of  rat  CYPs  (Supersomes TM )                 were used for studying EE2 oxidation. The results found in this work suggest that EE2 is a                promiscuous substrate of rat hepatic CYPs, among them the CYP3A and 2C enzymes seem to                 be most efficient.                1. INTRODUCTION                        The  oxidative  metabolism  of  EE2  has  been  studied  extensively.  It  undergoes                hydroxylation at the 2, 4, 6, and 16 α position of the steroid nucleus [1, 2]. The predominant                 route of the EE2 oxidative metabolism in both rat and human is its 2-hydroxylation [3]. A 2-                 hydroxyEE2 derivative can be subsequently methylated to give 2-methoxyethinylestradiol [2].                EE2 oxidation represents only a small portion of the total EE2 metabolism, which can occur                 by way of glucuronidation, methylation or sulfation [3].                       The cytochrome P450 (CYP) enzymes play a major role in hydroxylation of EE2. In                 early studies with antibody inhibition, CYP3A4 was reported as the major enzyme involved in                oxidation of EE2 in human liver [4]. Wang et al. [5] describe the CYP2C9 and 3A4 enzymes                 predominantly contributing to the 2-hydroxylation of EE2 in human liver microsomes. The                 authors also showed that recombinant CYP1A1, a predominantly extrahepatic CYP isozyme,                exhibited  higher  intrinsic  catalytic  activity  than  recombinant  CYP3A4  and/or  2C9.  Using                 immunoinhibitory CYP antibodies, Ball et al. [2] found that CYP2C and 2E could be involved                 in the 2-hydroxylation of EE2. However, in contrast to the results found by Wang et al. [5],                Ball et al. [2] postulated that CYP1A1 does not play an important role in EE2 metabolism.                        Since the discrepancies in data identifying CYP enzymes that participate in oxidation                of EE2, the aim of the present study was to extend our knowledge on this issue. The rat was                 used in the study as a suitable model to measure EE2 oxidation in human [6].                                                             15","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIALS AND METHODS                        Incubation mixtures contained in a final volume of 0.5 ml: 0.1 M potassium phosphate                buffer, pH 7.4, 50 µM EE2, 50 µl of NADPH-generating system and 0.5 µM microsomal CYP                                                                                                   o                or rat recombinant CYPs (50 pmol). The mixtures were incubated for 15 min at 37  C. The                reaction was terminated by addition of 1 ml of ethyl acetate. The metabolites were extracted                 and the extracts were evaporated to dryness. The residues were dissolved in the mobile phase                 for HPLC. EE2 and its metabolites were separated on Nucleosil column (C18, 4.6 x 250 mm,                5  m) with optimalized linear gradient elution. The mobile phase consisted of solvent A (20%                 acetonitrile) and solvent B (80% acetonitrile). Detection wavelenght and temperature used in                a HPLC separation were 280 nm and 35 °C, respectively .                 3. RESULTS AND DISCUSSION                        When  50  μM  EE2  was  incubated  with  rat  hepatic  microsomes  in  the  presence  of                NADPH,  three  metabolite  products  were  formed  and  separated  by  HPLC,  which  were                 characterized to be the X-OH EE2, 2-OH EE2 and a dehydrogenated metabolite of EE2.                        To  resolve  which  rat  CYP  enzymes  are  responsible  for  oxidation  of  EE2,  three                different  approaches  were  used:  (i)  the  use  of  CYP  inducers,  (ii)  specific  inhibitors  of                 individual CYPs, and (iii) the use of heterologous baculovirus expression systems of rat CYPs                (Supersomes  TM ).                        Add (i). An increase in formation of X-OH EE2 was formed in microsomes, in which                CYP2B/2C and 3A were induced by phenobarbital and PCN, respectively. Other inducers of                 CYPs  were  found  to  decrease  formation  of  this  metabolite.  Formation  of  2-OH  EE2  was                 increased  by  pretreatment  of  rats  with  EtOH  and  PB  indicating  that  CYP2B/2C  and  2E1                might be involved in 2-hydroxylation of EE2.                        Add (ii). The inhibition effect was studied using two different protocols. In the first                one, the reaction mixtures containing microsomes and a specific inhibitor were incubated 10                 min  in  the  presence  of  NADPH  before  an  addition  of  EE2.  In  the  other  protocol,  specific                inhibitors  were  pre-incubated  with  microsomes  for  the  same  time  interval,  but  without                 NADPH.                        All  tested  inhibitors  used  in  the  study  decreased  oxidation  of  EE2  to  X-OH  EE2.                Essentially  no  changes  in  inhibitory  capacity  of  α-naphtoflavone  and  ketoconazole  were                 detectable using both  experimental protocols. This  indicated reversible inhibition of X-OH                EE2  formation  by  these  compounds.  In  contrast  to  these  results,  the  inhibitory  potency  of                 diethyldithiocarbamate  (DDTC)  and  adamantane  increased  after  their  preincubation  with                 NADPH  and  microsomes.  These  results  indicate  that  during  pre-incubation  of  DDTC  and                                                            16","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    adamantane with microsomes and NADPH the reactive intermediates modifying CYP2B and                 2E1 activities with respect to X-OH formation are formed.                       Inhibition of 2-hydroxylation of EE2 was produced by adamantane and ketoconazole                 using the type of the inhibition protocol, where the reaction mixtures containing microsomes                and a specific inhibitor were incubated in the absence of NADPH before an addition of EE2.                 However,  under  these  conditions  almost  1.5-  fold  increase  in  amounts  of  2-OH  EE2  were                caused by α-NF,  a compound known to  stimulate CYP3A activities  [7,8],  sulphaphenazole                 and DDTC, respectively. Using the second type of inhibition protocol, EE2 oxidation to 2-OH                 EE2 was also inhibited by adamantane and ketoconazol. A higher degree of inhibition of 2-                OH EE2 formation was mediated by the pre-incubation of these inhibitors in the presence of                 NADPH. All these results indicated an important role of CYP3A in 2-hydroxylation of EE2,                but CYP2B and 2E1 could be also involved.                        Add (iii). Using Supersomes  TM , except of the rat CYP1A1 and 2D2 enzymes, other                recombinant CYPs used in the experiments oxidized EE2 to X-OH metabolite. Amounts of X-                 OH EE2 formed by these CYPs were, however, almost 10-times lower than those generated                 by hepatic microsomes. In the case of EE2 oxidation to 2-OH EE2, only CYP2A2, 2C6, 2D1                and 3A1/2 catalyzed this reaction. Only a degree of EE2 hydroxylation to this metabolite by                 CYP2A2 was similar to that found in hepatic microsomes.                 4. CONCLUSION                The results found in this study indicate that EE2 is a substrate of various rat hepatic CYPs that                 exhibit different efficiencies in oxidation of this endocrine disruptor.                5. ACKNOWLEDGEMENT                 The work has been supported by GACR (14-18344S in panel P301) and Charles University in                Prague (UNCE 204025/2012).                  5. REFERENCES                 [1]    Back D. J., Maggs J. L., Purba H. S., et al.: British Journal of Clinical Pharmacology 18 (1984), 603-607.                [2]    Ball S.E., Forrester L.M., Wolf C.R., et al.: Biochemical Journal 267 (1990), 221-226.                [3]    Ebner T., Remmel R.P. Burchell, B.: Molecular Pharmacology 43 (1993), 649-654.                [4]   Guengerich, F.P., 1988.: Molecular Pharmacology 33 (1988), 500-508.                 [5]    Wang B., Sanchez R.I., Franklin R.B., et al.: Drug Metabolism and Disposition 32 (2004), 1209-1212.                [6]    Laurenzana E.M., Weis C.C., Bryant C.W., et al: Food and Chemical Toxicology 40 (2002), 53-63.                [7]   Bořek-Dohalská L., Hodek P., Sulc M., et al.: Chemical and Biological Interaction 138 (2001), 85-106.                [8]   Bořek-Dohalská L., Stiborová M.: Collection of Czechoslovak Chemical Communication 75 (2010), 201-                      220.                                                               17","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                     STRUCTURE AND SPECTROSCOPIC CHARACTERIZATION OF COPPER(II)                                        COMPLEXES WITH FLUOROQUINOLONES                                              *                       Sandra DOROTÍKOVÁ , Júlia KOŽÍŠKOVÁ, Peter HERICH, Marek FRONC,                                         Lukáš BUČINSKÝ, Dana DVORANOVÁ                    Institute  of  Physical  Chemistry  and  Chemical  Physics,  Faculty  of  Chemical  and  Food                   Technology,  Slovak  University  of  Technology  in  Bratislava,  Radlinského  9,  SK-812  37                   Bratislava, Slovak Republic                    *sandra.dorotikova@stuba.sk                 Abstract                Copper  complexes  of  fluoroquinolones  in  the  presence  and  1,10-phenanthroline  have  been                 synthesized and characterized with X-ray, IR and UV-VIS spectroscopy and also by quantum                chemical calculations.                 1. INTRODUCTION                Fluoroquinolones  (FQs)  possess  variety  of  biological  activities  including  antimicrobial,                 antiviral  (anti-HIV)  and  antimalarial  effects.  Moreover,  FQs  have  been  demonstrated  to                                                       possess  antitumor  activity  hand  in  hand  with                                                      interesting mechanical effect on the DNA. Nowadays,                                                       the  attention  turns  to  the  synthesis  metal  complexes                                                       with  FQs  and  a  nitrogen  donor  heterocyclic  ligand,                                                      which increases  the biological  activity [1]. Thus, this                 Figure      1.:    Structure     of   work  is  focused  on  the  structure,  synthesis  and                [Cu(FQ)(phen)Cl];  FQ=6-fluoro-4-                oxo-1,4-dihydro-quinolone       -3-   spectroscopic  characterization  of  four  copper(II)                carboxilate                           complexes with FQs and 1,10-phenatroline (phen) and                compared with theoretical calculations.                   2. MATERIAL AND METHODS                The UV-VIS spectra of the studied complexes were measured in methanol (MeOH) and H 2O                 by means of UV-3600 UV-VIS-NIR spectrometer (Shimadzu, Japan) in a 1 cm square quartz                                                                  –1                cell.  Infrared  spectra  in  the  region  4000-700  cm   were  recorded  with  the  Nicolet  model                Nexus 470 FT-IR spectrometer at room temperature using reflectance ATR technique. X-ray                 diffraction data were collected on Oxford Diffraction Gemini R diffractometer equipped with                 Ruby  CCD  detector  and  Mo  Kα  sealed-tube  source  at  100K  or  room  temperature.  The                quantum chemical calculations were performed using Gaussian03 program package [2]. The                 copper  complexes  were  studied  at  B3LYP/6-311G*  theoretical  level.  Integral  Equation                                                            18","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Formalism Polarizable Continuum Model (IEFPCM) in solvent applied MeOH and H 2O was                 also  taken  into  account.  For  all  compounds  under  study  the  optimal  geometries  were                calculated; including IR line spectra and electron transitions using TD DFT treatment were                 computed to all studied compounds.                  3. RESULTS  AND  DISCUSSION                All complexes exhibit a d–d transition band in the UV–VIS spectra at 640 nm, typical for a                 distorted square pyramidal geometry. In the IR spectra of the complexes, the replacement of                                                                                                         –1                the valence stretching carboxylic vibration ν(C=O) carb of fluoroquinolones at 1672-1720 cm                                                               –1                by the asymmetric, ν(CO 2) asym, at 1587-1602 cm  and the symmetric stretching ν(CO 2) sym, in                                         –1                the  range  1364-1387  cm   are  indicative  that  fluoroquinolone  ligand  is  coordinated  to  the                metal via pyridone (O1) and carboxylate oxygen (O2) atoms (see Fig. 1). It was found, that                 the  copper  atom  is  five-coordinated,  which  confirmed  the  X-ray  and  quantum  chemical                calculations.  The  slightly  distorted  square  pyramid  geometry  is  built  of  a  bidentate                                                                  ¯                coordination of FQ and phen and a monodentate Cl  (and/or H 2O).                4. CONCLUSION                The structure and spectroscopic characterization of four copper complexes with the new FQs                 in  the  presence  of  phenantroline,  has  been  studied  experimentally  and  theoretically.  In  all                 complexes was found the formation of the neutral mononuclear complex.                  5. ACKNOWLEDGEMENT                This work was financially supported by the Research and Development Agency of the Slovak                 Republic  under  the  contracts  No.  APVV-0202-10  and  APVV-0339-10  and  the  Scientific                Grant Agency (VEGA Project 1/0289/12 and 1/0679/11). The calculations were performed at                 HPC  center,  SUT  Bratislava  (SIVVP  project,  ITMS  code  26230120002,  funded  by  the                 European region development funds) and Computing Centre SAS, code 26210120002 (Slovak                infrastructure for high-performance computing) supported by the Research \& Development                 Operational  Programme  funded  by  the  ERDF.  Kristína  Plevová  and  Viktor  Milata  are                gratefully acknowledged for synthesis of investigated derivatives.                  6. REFERENCES                 [1]Psomas G, Tharusi A, Efthimiadou K. E, et all.: Journal of Inorganic Biochemistry, 100 (2006), 1764-1773                [2]Frisch M.J., et al.: Gaussian 03, Revision C.02; Gaussian, Inc., Wallingford CT, (2004).                                                               19","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                             NAD(P)H:QUINONE OXIDOREDUCTASE 1 IS INDUCED BY 3-                  NITROBENZANTHRONE, ARISTOLOCHIC ACID, ELLIPTICINE, SUDAN I AND                                DICOUMAROL IN RATS - A COMPARATIVE STUDY                                      1*                                                             1                                                                                      1                                                                                                         1                 Marie STIBOROVÁ , Helena DRAČÍNSKÁ , Michaela MOSEROVÁ , Iveta MRÍZOVÁ ,                                                                          2                                                              1                                                 Věra ČERNÁ , Eva FREI                1   Department of Biochemistry, Faculty of Science, Charles University in Prague, Albertov 6,                   128 43 Prague 2, Czech Republic                2                   Division  of  Preventive  Oncology,  National  Center  for Tumor  Diseases,  German  Cancer                   Research Center (DKFZ), Im Neuenheimer Feld 280, 69 120 Heidelberg, Germany                 *stiborov@natur.cuni.cz                 Abstract                 Utilizing  the  Western  blotting  and  the  real-time  polymerase  chain  reaction  methods,                expression  of  NAD(P)H:quinone  oxidoreductase  1  (NQO1)  protein  and  its  mRNA,                 respectively, was found to be induced by treating rats with 3-nitrobenzanthrone (3-NBA), the                 plant extract aristolochic acid (AA), AAI, ellipticine, Sudan I and dicoumarol. Because these                chemicals  induced  the  expression  levels  of  NQO1  essential  for  metabolism  dictating                 biological  activities  of  a  variety  of  toxic  xenobiotics  including  three  of  these  inducers  (3-                NBA, AA and AAI), they exert concerted regulatory control on their own genotoxic effects as                 well as on potential toxic effects of numerous other environmental chemicals.                  1. INTRODUCTION                 Genotoxic effects of most carcinogens and pharmacological efficiencies of many drugs are                dependent on their metabolic activation. Although a majority of such xenobiotics is activated                 by oxidative reactions, participation of reductive metabolism in activation of xenobiotics is                unquestionable. Knowledge of enzymes participating in such reductive activations is crucial                 for many reasons. For example, it is important for elucidation of the fate of protoxicants and                 procarcinogens,  which  become  toxic  after  their  reductive  activation  in  organisms.                Furthermore, it is essential for the development of an ideal cancer chemotherapeutic prodrug,                 which would be fully inactive until reductively metabolized by tumor-specific enzymes, or by                an  enzyme  that  is  metabolically  competent  only  for  the  prodrug  under  physiological                 conditions and is unique for the tumor. An enzyme system that fulfils one or both of these                 criteria  might  be  the  cytosolic  enzyme,  NAD(P)H:quinone  oxidoreductase  (NQO1;  EC                                                                20","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    1.6.99.2.).  In  general,  NQO1  activity  is  higher  in  tumors  than  in  the  surrounding  normal                 tissues [1,2].                The  obligatory  two-electron  reduction  of  quinones  catalyzed  by  NQO1  circumvents  the                 semiquinone stage and thereby prevents redox cycling and alkylation by these highly reactive                compounds [1,2]. Likewise, reductive activation of numerous other compounds such as toxic                 chemicals  (azo  dyes  and  nitroso-  or  nitroaromatics)  or  anticancer  drugs  (e.g.  prodrugs                mitomycin  C  and  indoloquinone  EO9)  was  discovered  as  a  function  of  NQO1  [1-3].                 Expression and activities of NQO1 and/or other biotransformation enzymes (induction and/or                 repression)  might  be  essential  for  their  fate  in  organisms  as  well  as  for  their  toxic  or                pharmacological  efficiencies. The NQO1  enzyme is  inducible by a  variety of agents  [1,2].                 Two distinct regulatory elements in the 5’-flanking region of the NQO1 gene that have been                studied extensively are the antioxidant response element (ARE), also called the electrophile                 response  element  (EpRE),  and  the  xenobiotic  response  element  (XRE),  also  called  aryl                hydrocarbon response element (AhRE). The ARE and the XRE have been shown to mediate                 NQO1 induction as well as repression, in many cellular systems. Induction through the XRE                 involves  the  liganded  aromatic  hydrocarbon  receptor  (AhR).  ARE-mediated  NQO1  gene                expression is increased by a variety of antioxidants, tumor promoters and hydrogen peroxide                 [1,2].  Nuclear  factor-erythroid  2  (NF-E2)  related  factor  2  (Nrf2)  is  a  basic  leucine  zipper                 transcriptional factor that plays a key role in ARE-mediated NQO1 gene expression [1,2].                The aim of the present study was to compare a potency of several chemicals with different                 structure  to induce NQO1 in liver and kidney of rats.                  2. MATERIAL AND METHODS                Male Wistar rats were treated intraperitoneally or by a gavage with 3-NBA, the plant extract                 AA, AAI, ellipticine, Sudan I and dicoumarol as described previously [5-8]. Cytosols were                 isolated from the livers and kidneys of this animal model [5-8]. The method of Western blot,                employing an anti-rat NQO1 antibody, was utilized to evaluate expression of this enzyme. Its                 mRNA content in rat liver and kidney measured using the real-time polymerase chain reaction                (RT-PCR) and measurements of NQO1 enzyme activity were also carried out [5-8].                  3. RESULTS AND DISCUSSION                 Using a method of Western blotting with an antibody raised against rat NQO1 and the RT-                 PCR, the effects of exposure of rats to 3-NBA, the plant extract  AA, AAI, ellipticine, Sudan I                and dicoumarol on mRNA and protein expression levels of these proteins were analyzed. We                                                             21","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  found that these compounds were inducers of NQO1 in liver and kidney of rats both at the                 transcriptional and translational levels.  Up to more than 20-fold increases in NQO1 protein                expression  levels  were  produced  by  treatment  of  rats  with  these  compounds.  Of  them  the                 highest induction effect was caused by AA, followed by 3-NBA > Sudan I > ellipticine > AAI                >  dicoumarol.  The  increase  in  protein  levels  was  paralleled  by  an  increase  in  mRNA                 expression in most cases. In addition, an increased NQO1 enzyme activity of this enzyme,                measured either with menadione or 3-NBA, AA and AAI as substrates, corresponded to an                 induction potency of individual tested xenobiotics. Even though the mechanisms of NQO1                 induction  by  these  xenobiotics  are  still  not  clearly  explained,  it  can  be  suggested  that,                depending on the compound, both the ARE and the XRE might be capable of mediating the                 induction of NQO1 found in this work.  Nevertheless, the detailed studies investigating the                mechanisms of NQO1 induction by the tested chemical are needed to be performed and are                 planned to be carried out in our laboratory.                  4. CONCLUSION                 Utilizing the Western blotting method, expression of NQO1 protein was found to be induced                by treating rats with 3-NBA, the plant extract AA, AAI, ellipticine, Sudan I and dicoumarol.                 Since  these  compounds  induced  the  expression  levels  of  NQO1  that  is  essential  for  the                 metabolism of some of them, dictating their carcinogenic efficienceies (3-NBA, AA, AAI),                these compounds exert concerted regulatory control on their own genotoxic and carcinogenic                 effects.                  ACKNOWLEDGEMENT                The work has been supported by Grant Agency of the Czech Republic (14-18344S in panel                P301) and Charles University in Prague (UNCE 204025/2012 and 570513).                 5. REFERENCES                 [1]Ross D., Kepa J.K., Winski S.L., et al.: Chemico-Biological Interactions, 129 (2000), 77-97.                [2]Ross D.: Drug Metabolism Review, 36 (2004) 639-654.                [3]Patterson L.H., McKeown S.R., Robson T., et al.: Anti-cancer Drug Design, 14 (1999), 473-486.                 [4]Stiborová M., Dračínská H., Hájková J., et al.: Drug Metabolism and Disposition, 34 (2006), 1398-1405.                [5] Stiborová M., Dračínská H, Aimová D., et al.: Collection of Czechoslovak Chemical Communications, 72                (2007), 1350-1364.                [6]Mizerovská J., Dračínská H., Frei E., et al.: Mutation Research, 720 (2011), 34-41                [7] Stiborová M, Dračínská H, Martínek V, et al.: Chemical Research in Toxicology, 25 (2013), 290-299.                [8]Stiborová M., Levová K., Bárta F., et al.: Mutagenesis, 29 (2014), 189-200.                                                             22","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      STUDY OF STRUCTURE AND CHEMICAL COMPOSITION OF SOIL                         HUMIC SUBSTANCES ISOLATED FROM HUMIC PODZOL                                                                                             2                                             1*                                                                        1                               Vojtěch ENEV , Martina KLUČÁKOVÁ , František NOVÁK                 1                       Centre for Materials Research, Faculty of Chemistry, Brno University of Technology,                 Purkyňova 118, 612 00 Brno, Czech Republic                 2     Biology  Centre AS  CR  v.v.i.,  Institute  of  soil  Biology,  Na  sádkách  7,  370  05  České                  Budějovice, Czech Republic                  *xcenev@fch.vutbr.cz                 Abstract                The aim of this work was study chemical composition and structure of soil humic substances                (HS). Object of our study were three samples HS which were isolated from Humic Podzol                 (locality  Krkonoše,  Czech  Republic).  Isolation  of  HS  was  performed  according  to  the                 procedure recommended by the International Humic Substances Society. All samples of HS                were  characterized  by  elemental  analysis  (EA),  ultraviolet-visible  spectroscopy  (UV/Vis),                 infrared  spectroscopy  (FTIR)  and  steady-state  fluorescence  spectroscopy.  Absorption                coefficients  (E ET/E Bz,  E 2/E 3 and  E 4/E 6) of HS  were  calculated from  the  absorbance values.                 Fluorescence coefficients (Milori index and Zsolnay index) of HS were calculated from the                 area of the emission spectra.                  1. INTRODUCTION                Humic substances (HS) are a major component of natural organic matter (NOM) and are the                dominant  products  of  plant  and  animal  degradation  by  microbial  activity.  HS,  the  main                 organic  constituents  of  soil  and  sediments  are  widely  distributed  over  the  earth’s  surface,                occurring in almost all terrestrial and aquatic environments. Humic substances are complex                 mixtures of high to low molecular weight species, so they are polydisperse systems with a                specific distribution of molecular weights. From a theoretical viewpoint, a better knowledge                 of  the  chemical  structure  of  HS  is  fundamental  in  order  to  more  fully  understand  a  great                 number  of  natural  processes  occurring  in  natural  ecosystems,  such  as  the  dynamics  of                different elements, principally micronutrients, the transport of xenobiotics or the development                 of plants and microorganisms; as well as those question related to the chemical features of                HS.  The  following  spectroscopic  techniques  are  prominent  among  those  used  for                 characterization of HS: UV/Vis spectroscopy, Fourier-transform infrared spectroscopy (FTIR)                                                                 23","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  and fluorescence spectroscopy. In addition to those techniques, fluorescence spectroscopy has                 also been used in the study of HS [1].                 2. MATERIAL AND METHODS                The objects of our study were three different samples of HS. HAs and FA were isolated from                Humic  Podzol  (locality  Krkonoše,  Czech  Republic).  UV-VIS  spectra  of  aqueous  solutions                 were measured by spectrophotometer Hitachi  U-3900 in  the wavelength  range of 200–900                nm.  Absorption  coefficients  (E ET/E Bz,  E 2/E 3  and  E 4/E 6)  of  HS  were  calculated  from  the                 absorbance of aqueous solutions HS in UV/Vis spectral range. The Fourier transform infrared                                                                                   −1                spectra (FTIR) of HS were recorded over the range of 4000–400 cm  on pellets obtained by                pressing under reduced  pressure  a mixture of 1 mg of samples  and 400 mg of dried  KBr,                 spectrometry grade. A Nicolet iS50 FTIR spectrophotometer operating with a peak resolution                        −1                of 4 cm , and 128 scans were performed on each acquisition. Nicolet Omnic software was                used  to  obtain  the  spectra.  For  the  fluorescence  experiments  the  final  concentration  of  the                                               –3                HAs was adjusted to 10 mg·dm . The pH-value of the samples was adjusted to seven using a                standard phosphate buffer. Total luminescence spectra (TLS) were obtained in the form of                 excitation/emission  matrix  (EEM)  by  scanning  the  wavelength  emission  over  the  range  of                300–600 nm,  also  the excitation wavelength  was  in  5 nm  steps from 240 to  550 nm.  The                 following  fluorescence  coefficients  were  obtained:  (i) Milori  index:  Emission  spectra  were                collected over the range of 460–650 nm using an excitation wavelength of 440 nm, and the                 total area under these spectra was calculated [2]. (ii) Zsolnay index (HIX): HIX is calculated                 from  the  ratio  of  two  integrated  regions  of  an  emission  scan  (sum  from  λ Em  435–480 nm                divided by the sum from λ Em 300–345 nm) using a fixed excitation (λ Ex 254 nm) [3].                 The fluorescence intensity (I F) values (in CPS/MicroAmp.) of samples were corrected using                method of Lakowicz [4]. The correction method of Lakowicz uses:                                                                             ,                            (1)                 where F corr and F obs are the corrected and uncorrected fluorescence intensities and A ex and A em                are the absorbance values at the current excitation and emission wavelengths. The path of the                 exciting  light  is  assumed  to  be  equal  to  the  path  of  the  emitted  light.  Primary  inner  filter                 effects are corrected as well as secondary inner filter effects.                 3. RESULTS  AND  DISCUSSION                The values of the different indexes calculated from the UV-VIS spectra (E ET/E Bz, E 2/E 3 and                E 4/E 6) and elemental composition are presented in Table 1. The higher values of ratio E ET/E Bz                 of  A55 HA  (Humic  Podzol)  may  be  indicative  of  the  presence  of  O-containing  functional                                                            24","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    groups  (hydroxyl,  carbonyl,  carboxyl  and  ester  groups).  Calculated  value  of  humification                 index (ratio E 4/E 6) was lower for A55 HA isolated from Humic Podzol, which show on \"light                brown\"  HA  with  higher  molecular  mass.  The  high  values  of  humification  index  for  HS                 isolated from organic horizon (A15 w HA and A15 w FA) confirmed the presence of HS with                lower molecular mass and humification degree. Absorption coefficients  E 2/E 3 of HS are in                 good agreement with calculated values of index E 4/E 6.                 Table 1: Elemental composition (weight %) and absorption coefficients (E ET/E Bz, E 2/E 3 and                E 4/E 6) of HS                   HS samples  C [%]  H [%]  N [%]  S [%]  O [%]  P [%]  ash [%]  E ET /E Bz   E 2 /E 3   E 4 /E 6                     A55 HA    42.91   4.30    4.00     –    30.52   1.08    17.19    0.76   2.82   5.62                    A15 w HA   55.80   5.36    1.93     –    35.55    –      1.37     0.47   3.18   8.71                    A15 w FA   50.49   4.71    0.89     –    37.96    –      5.95     0.53   3.76   11.30                 All spectra feature common and distinctive absorption bands, with some differences in their                 relative intensity. The main characteristics of these spectra  are the  following:  about  3400–                         −1                3300 cm  (O–H stretching and, secondarily, N–H stretching of various functional groups);                                     −1                about  2935–2925 cm   (asymmetric  C–H  stretching  or  of  CH 2  groups);  about  1720–1710                   −1                cm   (C=O  stretching  of  COOH),  whose  higher  relative  intensity  was  determined  for  FA;                               −1                1620–1600 cm  (aromatic C=C skeletal vibrations, C=O of strongly H-bonded conjugated                                                                                           −1                ketones, whose higher intensity were determined for HAs; about ≈1510 cm  (preferentially                ascribed  to  simple  aromatic  C=C  vibrations,  N–H  deformation  and,  C=N  stretching  of                                          −1                amides);  about  1420  cm   (O–H  deformation  and  C–O  stretching  of  phenolic  OH);  about                          −1                ≈1380  cm   (C–H  deformation  of  CH 2  and  CH 3  groups,  and/or  asymmetric  stretching  of                     −                                                    −1                COO  groups); about 1270–1260 cm  (C=O stretching of aryl esters), whose higher intensity                                                                                  −1                were detected for HAs (A15 w HA and A15 w FA); about 1220 cm  (C–O stretching of aryl                                                   −1                ethers and phenols); 1130–1080 cm  (C–O stretching of secondary alcohols and/or ethers);                                                 −1                and, finally, about 1045–1041 cm  (C–O stretching of polysaccharides or polysaccharide-like                substances, and/or Si–O of silicate impurities). The results provided by FTIR spectroscopy are                 in good agreement with elemental analysis and UV/Vis spectroscopy.                 The values of the fluorescence intensity and excitation-emission wavelength pair of the main                peaks in the EEM spectra and fluorescence coefficients of HS are presented in Table 2. The                 fluorescence  EEM  spectrum  of  A15 w HA  was  characterized  by  two  unique  fluorophores                centered  at  an  excitation/emission  wavelength  pair  (EEWP)  of  275/425 nm  (peak  A)  and                 380/450 nm (peak C). The fluorescence EEM spectrum of A55 HA was characterized by three                unique  fluorophores  centered  at  an  excitation/emission  wavelength  pair  (EEWP)  of                                                               25","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  270/500 nm (peak A), 360/500 nm (peak C 1) and 445/510 nm (peak C 2). The long wavelength                 and less fluorescence intensity of the major peaks of HAs may be ascribed to the presence of                an extended, linearly-condensed aromatic ring network, and other unsaturated bond systems                 capable  of  a  great  degree  of  conjugation  in  large  molecular  size  and  extensively  humified                “macromolecules”.  The  fluorescence  EEM  spectrum  of  A15 w FA  were  located  by  three                 fluorescence maxima at an excitation/emission wavelength pair of 250/430 nm (fulvic-like),                310/430 nm  (humic-like)  and  270/310 nm  (tyrosine-like)  which  are  typical  for  terrestrial                 origin. On the contrary, the prevalence of fluorescence bands  and peaks with high relative                 intensity at short wavelengths, such as those measured for the peaks of FA, is associated with                the  presence  of  simple  structural  components  of  wide  molecular  heterogeneity  and  small                 molecular  weight,  small  degree  of  aromatic  condensation,  small  level  of  conjugated                fluorophores, and small humification degree.                                         Figure 1: Excitation-emission spectrum of fulvic acid isolated from organic horizon of soil                Humic Podzol                 Table  2:  Position  of  excitation-emission  wavelength  pair  of  the  main  peaks  in  the  EEM                spectra and values of fluorescence intensity these fluorescence peaks of HS                                       peak fulvic-like     peak humic-like      peak tyrosine-like                         sample HS                                     EEWP [nm]  I F  [CPS]  EEWP [nm]  I F  [CPS]  EEWP [nm]  I F  [CPS]                                                           360/500    2153173                          A55 HA      270/500    6408185                           –          –                                                           445/510    1611386                         A15 w HA     275/425    3937767   380/450    1015414      –          –                          A15 w FA    250/430    7039711   310/430    4764966   270/310    4606052                Also, values of Zsolnay and Milori index of HS are in agreement with previous results.                 4. CONCLUSION                Our results showed that the chemical properties of the different HS used in these experiments                were well described using  five  complementary  indexes derived from the ultraviolet-visible                 and fluorescence spectra (E ET/E Bz ratio,  E 2/E 3  ratio,  E 4/E 6, Zsolnay and  Milori  index). Soil                                                             26","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    A55 HA was characterized high molecular weight, low molecular heterogeneity, high degree                 of aromatic polycondensation, high level of conjugated fluorophores, and high humification                degree. HS isolated from organic horizon were characterized lower molecular mass, simple                 structural  components  of  wide  molecular  heterogeneity,  lower  degree  of  aromatic                polycondensation, and lower humification degree.                  5. ACKNOWLEDGEMENT                This work has been supported by Ministry of Education, Youth and Sports, Project LO1211.                  6. REFERENCES                [1]Stevenson F. J, Humus Chemistry: Genesis, Composition, Reactions. Wiley-Interscience, New York.                [2]Milori D, Martin-Neto L, et all.: Soil Science, 167 (2002), 739–749                [3]Zsolnay A, Baigar E, et all.: Chemosphere, 38 (1999), 45–50                 [4]Lakowicz, J. 2006. Principles of fluorescence spectroscopy. 3rd ed. New York: Springer.                                                                                                  27","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                     EFFECT OF BITUMEN ON SORPTION PROPERTIES OF LIGNITE                                                                                        1                                                     1                                                                     1*                                    Leoš DOSKOČIL , Vojtěch ENEV , Miloslav Pekař                1                       Centre for Materials Research, Faculty of Chemistry, Brno University of Technology,                Purkyňova 118, 612 00 Brno, Czech Republic.                *xcenev@fch.vutbr.cz                  Abstract                The effect of bitumen on sorption properties of the South Moravian lignite was investigated.                 Methylene blue and copper ion were selected as sorbates for sorption tests. The absence of                 bitumen in lignite resulted in a higher sorption efficiency of copper ions and a lower one of                methylene blue compared with lignitem before the extraction with chloroform.                  1. INTRODUCTION                 Lignite is young coal with a high content of water, oxygen, humic acids (up to 70 wt%) and                 with  low caloric value. It  could  not  be therefore viewed as  a fuel  but  rather as a valuable                natural product and chemical raw material. Hence, lignite can be used as a sorbent of heavy                 metals, dyes etc. From water [1].                Bitumen represents an extractable non-polar part of lignite which is formed by predominantly                 aliphatic structures, in smaller degree aromatic molecules and functional groups comprising                carboxyl acids, esters, ethers, alcohols and highly conjugated carbonyl groups [2].                 Sorption  of  methylene  blue  on  lignite  is  explained  by  ion-exchange  interactions  through                 positive charge of nitrogen (alternatively sulphur) of molecule and/or carboxyl, phenol groups                [3, 4].  Similarly,  mechanism  of  sorption  of  heavy  metals  on  lignite  is  explained  by  ion-                 exchange interactions and the formation of metal complexes [5, 6].                The  objective  of  this  work  is  to  determine  the effect  of  bitumen  on  sorption  properties  of                 lignite using methylene blue and copper ions as sorbates.                  2. MATERIAL AND METHODS                 Lignite  (Mikulčice,  Czech  Republic)  was  used  in  its  natural  state  before  and  after  the                extraction with chloroform. By Soxhlet extraction with CHCl 3, bitumen was obtained from                 lignite. The size fraction of samples less than 0.2 mm was used for sorption tests.                 Sorption procedure was performed for this study as follows: 0.1 g of samples was weighted                                                                              −1                and 20 ml of methylene blue solution (1000, 500 and 250 mg L ) or of copper ions solution                                                              28","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                        −1                (500, 350, 200, 100, 50 and 10 mg L ) was added. Values of pH of prepared solutions were                about  5. The suspensions were shaken for 24 h  under ambient  temperature. After sorption                tests, equilibrium concentration of methylene blue or copper ions was determined by UV-Vis                 spectrometry  (ultraviolet-visible  spectrophotometry,  Hitachi  U-3900H)  or  AAS  (atomic                absorption spectroscopy, Varian SpectrAA-30), respectively. All experiments were performed                 in triplicates; the standard deviation did not exceed 5 %.                  3. RESULTS  AND  DISCUSSION                 Results of sorption tests of methylene blue on lignite and bitumen-free lignite are show in                Fig. 1.  The  adsorption  capacity  of  methylene  blue  on  lignite  is  higher  in  compare  with                 bitumen-free  lignite.  Differences  between  adsorption  capacities  are  more  pronounced  with                increasing initial concentration of the dye. The extraction of bitumen resulted in pH decrease                 in aqueous leaching of bitumen-free lignite (pH 5.9) contrary to lignite (pH 6.2). Thus, higher                acidity of lignite after the extraction should lead to greater sorption efficiency of methylene                 blue according to the mechanism of sorption. This fact is not observed probably due to the                 hydrophobic character of the methylene blue molecule. Methylene blue may thus interact with                the  bitumen  to  be  stabilized  and  dispersion  forces  and  hydrophobic  interactions.  In  the                 absence of bitumen in lignite, methylene blue molecules can not apparently penetrate deeper                 into the structure and interact with other carboxyl groups due to their hydrophobic nature.                       120                                L      LV                      100                       80                     a (mg g -1 )  60                         40                       20                         0                                 250              500            1000                                                      -1                                               c (mg L )                Figure 1.: Dependence of adsorption capacity on initial concentration of methylene blue onto                lignite (L) and bitumen-free lignite (LV).                  Results of sorption tests of copper ions on lignite and bitumen-free lignite are show in Fig. 2.                                                                        2+                As can be seen, the absorption capacity of lignite for Cu  is smaller compared to the sorption                capacity  of  lignite  extracted  with  chloroform.  Lower  sorption  efficiency  of  lignite  in                                                             29","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  compared  to  bitumen-free  lignite  is  in  contrast  to  the  observation  of  the  methylene  blue                 adsorption.  This  fact  can  be  explained  similarly  as  in  the  previous  case.  By  removal  of                bitumen  from  lignite,  acidic  functional  groups  become  accessible  to  the  dissociation  of                 hydrogen  and  the  space  around  them  is  accessible  to  hydrophilic  molecules.  The  water-                solvated copper ions can gradually adsorb on sites that were previously inaccessible due to                 bitumen molecules.                         60                       50                       40                     a (mg g -1 )  30                         20                       10                        0                         0        50       100      150       200       250      300                                                        -1                                                  c (mg L )                 Figure 2.: Dependence of adsorption capacity on equilibrium concentration of copper ions                onto  lignite  (blue)  and  bitumen-free  ignite  red).  Experimental  points  are  fitted  to  the                 Freundlich equation (dashed line) and Langmuir equation (continuous line).                  MATLAB software was used to fit experimental data to Freundlich and Langmuir equations.                 The data were better fitted to the Langmuir equation (paramters not shown). The maximum                                                                                                     −1                adsorption capacities calculated from Langmuir isotherms were for lignite 26.74 mg g  and                                                       −1                for lignite withaout bitumen 34.60 mg g .                  4. CONCLUSION                 Bitumen in lignite has the positive effect on the sorption of methylene blue probably due to                dispersion forces and hydrophobic interactions. Vice versa, bitumen has the negative effect on                 the  sorption  of  copper  ions  because  the  adsorption  capacity  of  lignite  was  lower  than  the                capacity  of  bitumen-free  lignite.  The  maximum  adsorption  capacities  calculated  from                                                                  −1                Langmuir  isotherms  were  for  lignite  26.74  mg g   and  for  lignite  withaout  bitumen  34.60                     −1                mg g .                                                              30","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      5. ACKNOWLEDGEMENT                 This work has been supported by Ministry of Education, Youth and Sports,Project LO1211.                  6. REFERENCES                 [1]Doskocil L, Pekar M: Fuel Processing Technology, 101 (2012), 29-34                [2]Stefanova M, Ivanov D, Yavena N, et all.: Organic Geochemistry, 39 (2008), 11, 1589-1605                [3]Rafatullah M, Sulaiman O, Hashim R, et all.: Journal of Hazardous Materials, 177 (2010), 1-3, 70-80                [4]Qi Y, Andrew F, Hoadley A, et all.: Fuel, 90 (2011), 4, 1567-1574                [5]Pehlivan E, Gode A: Fuel Processing Technology, 88 (2007), 1, 99-106                [6]Jochova M, Puncochar M, Horacek J, et al.: Fuel, 83 (2004), 9, 1197-1203                                                                                                       31","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                            PIEZOELECTRIC BIOSENSORS FOR DETECTION OF                                                 MICROORGANISMS                                                                                        1,2                                                  1,*                                                                    1,2                                  Zdeněk FARKA , David KOVÁŘ , Petr SKLÁDAL                1                   Department of Biochemistry, Faculty of Science, Masaryk University, Kotlářská 2, 611 37                   Brno, Czech Republic                2   CEITEC MU, Masaryk University, Kamenice 5, 625 00 Brno, Czech Republic                    *farka@mail.muni.cz                  Abstract                 Piezoelectric biosensors provide fast, specific and economic way of detection for a wide range                 of  analytes  ranging  from  metabolites  to  microorganisms.  Specific  antibodies  were                immobilised on gold electrodes of piezoelectric crystal and the biosensor was applied for real-                 time  detection  of  model  microorganisms.  Three  nonpathogenic  strains  of  Escherichia coli                (BL21, DH5α and K-12) were used because of easy cultivation and availability of antibodies.                 Several methods of antibody immobilisation were compared. The immobilisation of reduced                antibody using Sulfo-SMCC was the most effective achieving the limit of detection (LOD)                    5                             −1                10  CFU·mL .  Active  and  passive  operation  modes  of  quartz  crystal  microbalance  were                compared concluding that for detection of microorganisms, both approaches are practically                identical.  The  developed  biosensor  was  connected  to  the  cyclone  air  sampler  allowing                 detection of microorganisms disseminated in the form of aerosol inside bioaerosol chamber.                                                         −1                                                 4                The  achieved  LOD  was  1.45·10  CFU·L   of  air  and  the  time  from  sample  collection  to                detection was 16 min.                  1. INTRODUCTION                 Monitoring  of  microorganisms  has  a  crucial  role  in  many  fields.  The  traditional                 microbiological  methods  are  reliable  but  not  suitable  for  fast  detection. The  need  of  rapid                detection is  met by piezoelectric biosensors  that  are also sensitive, specific and cheap [1].                 There are two possible operational modes of measurements with piezoelectric biosensors  –                 active one, where crystal oscillates and its resonance frequency is measured using frequency                counter [2], and passive one, where detailed impedance characteristics of the resonator are                 measured  [3].  The  passive  mode  requires  more  expensive  equipment  but  can  differentiate                changes of mass and viscosity [4].                                                                32","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                 Microorganisms and antibodies                Three  strains  of  E.  coli  (BL21,  DH5α  and  K-12)  were  cultivated  aerobically  in  LB  Broth                 (Duchefa  Biochemie,  Netherlands)  at  37 °C  overnight.  The  obtained  suspension  was                 centrifuged thrice at 4500 RCF for 10 min and resuspended in 50 mM PBS (pH 7.4). Two                antibodies were used, Abcam ab25823 for detection of strains BL21 and DH5α and Serotec                 4329-4906 for detection of K-12.                  Piezoelectric immunoassay                The antibodies were immobilised to gold electrodes of 10 MHz quartz crystals (ICM, USA)                 using  three  different  approaches.  In  the  first  one,  the  sensor  surface  was  activated  using                                       −1                cysteamine (20 mg·mL , 2 h), glutaraldehyde (5 %, 1 h) and staphylococcal protein A (SpA,                         −1                1 mg·mL ,  20 h)  that  specifically  binds  Fc  fragments  of  antibodies.  In  the  next  step,  the                                                 −1                antibody  was  bound  (100 µg·mL ,  20 h)  and  free  reactive  groups  were  deactivated  using                ethanolamine (50 mM, 30 min). The second approach was based on the same procedure but                the antibody was bound directly to  glutaraldehyde omitting the SpA. The last method was                                                                  −1                based on binding of reduced antibody (100 µg·mL ) to cysteamine-modified sensor surface                                             −1                using Sulfo-SMCC (3 mg·mL ) [5].                The prepared sensor was placed in a flow-through cell and affinity interactions were measured                in  real-time  using  either  active  (QCM  Analyzer,  KEVA,  Czech  Rep.)  or  passive  mode                 (Agilent  4294A,  Agilent,  USA),  in  both  cases  PBS  was  used  as  a  running  buffer.  The                 microbes  were  disseminated  inside  an  in-house  made  bioaerosol  chamber  and  captured  by                cyclone SASS 2300 (Research International, USA). The piezoelectric biosensor was on-line                 coupled with the cyclone allowing remote control.                  3. RESULTS AND DISCUSSION                 Interactions  of  E.  coli  with  antibodies  were  studied  using  piezoelectric  biosensor.  Fig. 1                 shows  calibration  curves  for  combinations  of  E.  coli  strain  and  antibody  immobilisation                method  measured  using  the  active  method.  The  dependence  of  signal  on  concentration                 exhibits saturation character and therefore linearisation by transforming x axis to log-scale is                typically  done.  The  highest  sensitivity  was  achieved  using  the  sensor  with  antibody                 immobilised  using  protein  A,  but  surprisingly  this  sensor  provided  the  worst  LOD                                                                                                         −1                                                                                               6                     6                               −1                (5·10  CFU·mL ). The sensor with antibody immobilised directly had LOD 10  CFU·mL                                                            33","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                                  −1                                                                      5                for all tested E. coli strains. The best results (LOD 10  CFU·mL ) were achieved using the                sensor with reduced antibody linked using Sulfo-SMCC. Measurements in the passive mode                were done too, but no improvement of LOD was achieved with the impedance analyser.                                                Figure 1: Calibration curves for QCM biosensors with antibodies immobilised using various                 procedures. GA – antibody linked directly using glutaraldehyde, SpA – antibody immobilised                using staphylococcal protein A, SMCC – reduced antibody immobilised using Sulfo-SMCC.                                                Figure  2:  The  interactions  of  E.  coli  K-12  captured  from  aerosol  with  reduced  antibody                 Serotec  4329-4906  immobilised  using  Suflo-SMCC.  Change  of  resonant  frequency  ( f)  in                time is shown.                                                             34","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Using  the  developed  biosensors,  measurements  of  bioaerosols  were  done.  Fig. 2  shows                 interactions  between  E.  coli  K-12  and  antibody  immobilised  using  Sulfo-SMCC.                                                                                     −1                                                                             4                Measurements with this sensor were done with LOD 1.45·10  CFU·L  of air based on the                levels expected from the disseminated amounts of microbes. Time from sample collection to                detection was 16 min. LODs for bioaerosol detection that are comparable to infection doses of                 various pathogens [6] were allowed by preconcentration effect of the cyclone air sampler.                  4. CONCLUSION                 Piezoelectric biosensor for rapid detection of microorganisms was developed and tested with                                                                                           5                                                                                                     −1                three strains of E. coli (BL21, DH5α and K-12). For liquid samples, LOD 10  CFU·mL  was                achieved  using  sensor  with  reduced  antibody  immobilised  by  Sulfo-SMCC,  detection  time                was 10 min. Active and passive modes of QCM were compared but no major differences were                 observed  in  case  of  microorganism  detection.  The  developed  immunosensor  was  finally                connected  to  cyclone  air  sampler  which  allowed  detection  of  microorganisms  in  form  of                                                                −1                                                       4                aerosol. The achieved LOD was 1.45·10  CFU·L  of air with the time from sample collection                to detection 16 min. The obtained data demonstrate that piezoelectric biosensors have great                potential for fast and reliable detection of microorganisms.                   5. ACKNOWLEDGEMENT                The  work  has  been  supported  by  the  Ministry  of  Defence  of  Czech  Republic  (projects                 no. OVVTUO2008001 and OSVTUO2006003) and by CEITEC – Central European Institute                of Technology (CZ.1.05/1.1.00/02.0068) from European Regional Development Fund.                  6. REFERENCES                 [1]Farka Z, Kovář D, Přibyl J, Skládal P: Int. J. Electrochem. Sci. 8 (2013), 1, 100-112                [2]Arnau A: Sensors. 8 (2008), 1, 370-411                [3]Zhang J, Su X D, O’Shea S J: Biophys. Chem. 99 (2002), 1, 31-41                 [4]Itoh A, Ichihashi M: Meas. Sci. Technol. 19 (2008), 7                [5]Hermanson G T: Bioconjugate Techniques, Academic Press, London, 2008                [6]Sabelnikov A, Zhukov V, Kempf R: Biosens. Bioelectron. 21 (2006), 11, 2070-2077                                                                      35","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                   HIGH PERFORMANCE SULFUR NANOCOMPOSITES AS CATHODE                             MATERIALS BASED ON CONVERSION REACTION                                                                                1                                                                                                1                         Andrea STRAKOVÁ FEDORKOVÁ           1,2* , Ondrej ČECH , Tomáš KAZDA ,                                                           2                                                                                     1                                      Renáta ORIŇÁKOVÁ , Marie SEDLAŘÍKOVÁ                1                 Department of Electrical and Electronic Technology, Faculty of Electrical Engineering and                Communication, Brno University of Technology, Technicka 10, 616 00 Brno, Czech Republic                2                 Institute of Chemistry, Faculty of Science, P.J. Šafárik University, Moyzesova 11, SK-041 54                Košice, Slovakia                * andrea.fedorkova@upjs.sk                   Abstract                Li/S batteries are potentially viable ultrahigh energy density chemical power sources, which                                                                         −1                could potentially offer specific energies up to 2600 Whkg  being rechargeable. It possesses                the advantages of low cost, environmentally benign and high safety characteristics. Sulfur-                 carbon  (S-C)  composites  and  sulfur-LiFePO 4  (S-LFP)  composites  were  prepared  with                MWCNTs additive by evaporation and solid state reaction. It is found that the S-LFP cathode                 with MWCNTs shows improvement of not only discharge capacity but also cycling stability.                 It exhibits an initial discharge capacity of 1167 mAh/g sulfur, or 70% of theoretical capacity.                The capacity of S-LFP-MWCNTs composite after 20 cycles was 80% of the initial value and                 remained stable.                  1. INTRODUCTION                 The  lithium-sulfur  battery  is  a  “conversion”  type  battery,  because  the  electrochemical                reactions  which  take  place  during  charging  and  discharging  of  the  battery  result  in  new                 chemical compounds [1-3]. By contrast, lithium-ion batteries operate in accordance with the                “insertion” principle. This means that lithium ions occupy spaces in the crystal structure of the                 cathode, without substantially changing the structure of the cathode material (Fig 1). Sulfur as                                                                                          -1                the active cathode material has a theoretical specific capacity of 1672 mAhg  and an average                discharge potential of 2.2 V versus lithium. While for lithium ion batteries using intercalation                                                                       -1                cathodes  a  limit  in  energy  density  of  about  200 Whkg  is  expected,  for  the  lithium  sulfur                                                          -1                battery energy densities of up to 600 Wh kg might be achievable. Furthermore cost reduction                and safety increase are attractive features since sulfur is widely available, less expensive and                less  toxic  when  compared  to  conventional  cathodes.  However,  various  challenges  are                                                               36","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    connected  to  the  lithium  sulfur  cell  chemistry,  which  need  to  be  solved  within  systematic                 studies and by the development of new material concepts. In the present work, we report a                simple method to synthesize S-C and S-LFP cathode material with MWCNTs as additional                 electronic  conductor.  SEM  studies  of  morphological  changes  of  the  cathodes,                thermogravimetry and charge–discharge performance of the S-C and S-LFP composites with                 MWCNTs were used to investigate and characterize the sulfur electrodes.                                                     Figure 1.: Comparison of Intercalation and conversion reaction for energy storage [4].                  2. RESULTS  AND  DISCUSSION                 The  morphologies  of  the  S-based  composite  electrodes  were  investigated  by  SEM.  Two                 different  structures  were  observed  for  S-C  composite.  The  surface  of  the  Sulfur-Carbon                                                                                                      +                sample is compact without cracks or holes but the structure is porous enough to enable Li  ion                transport  and  electrolyte  penetration.  The  porous  and  homogeneous  basis  of  sample  with                MWCNTs  is  retained  but  addition  of  MWCNTs  caused  the  formation  of  larger  pores  and                 holes. The MWCNTs are also clearly visible and provide the connections between S and C. In                the  case  of  S-LFP  a  coarser  granularity  is  observed  as  compared  with  S-C.  Yet,  the                 corresponding  S-LFP-MWCNTs  composite  presents  a  more  homogeneous  structure  with                 oriented fibres of MWCNTs on the surface. Thus, the presence of MWCNTs in both samples                was found to cause a significant change in porosity and homogeneity.                                                             37","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Figure 2a shows a moderate capacity loss from the initial high values of ca. 1160 mAh/g-                 sulfur down to values of specific capacities still larger than 800 mAh/g-sulfur after 10 cycles.                It should be underscored that these values, still remarkably large, remain stable in subsequent                 cycles. It can also be noted that the S-LFP-MWCNT cathode presents a stabilized specific                capacity of 980 mAh/g-sulfur a 20 % higher than that of S-C-MWCNT (780 mAh/g-sulfur).                 The discharge capacity gradually decreases as the current rate is raised from 0.1 C to 0.5 C for                both of the cells (Fig. 2b). The higher discharge capacities of 1170, 855 and 750 mAh/g-sulfur                 were achieved at a current density of 0.1, 0.2, and 0.5 C, respectively for S-LFP composite                 material.  The  excellent  rate  performance  can  be  ascribed  to  the  high  effective  electron                pathways  provided  by  the  MWCNTs  and  an  optimal  distribution  of  pores  as  electrolyte                 channels in the cathode.                                      Figure  2.:  Discharge  capacity  vs.  cycle  number  measured  on  S-C-MWCNTs  and  S-LFP-                 MWCNTs cathodes at C-rate C/10 (a), cycling performance of S-C-MWCNTs and S-LFP-                MWCNTs cathodes at various C-rates (b).                  3. CONCLUSION                 Sulfur-carbon composite was synthesized by thermal heating of sulfur onto conductive carbon                black (Super P). Sulfur-LFP composite was prepared by simple solid-state reaction in a ball                 mill. These  simple  methods  have  been  shown  here  to  produce  very  porous  sulfur  cathode                 composites. A high initial  discharge capacity of 1167 mAh/g-sulfur at  0.1 C was  achieved                with  the  S-LFP-MWCNTs  composite.  The  excellent  electrochemical  performance  can  be                 attributed  to  the  homogeneous  dispersion  of  MWCNTs  in  the  composites,  which  not  only                accommodate  the  volume  change  during  charge/discharge  processes,  and  absorb  the                 polysulfides  byproducts  but  also  provide  stable  electrical  and  ionic  transfer  channels.  All                results described in  this publication  indicate that the combination  of sulphur,  LiFePO 4  and                                                               38","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    MWCNTs  is  a  promising  candidate  cathode  material  for  high-performance  lithium/sulfur                 batteries.                  4. ACKNOWLEDGEMENT                Authors gratefully acknowledge financial support from the Ministry of Education, Youth and                 Sports under projects No. LO1210 - \"Energy for Sustainable Development (EN-PUR)\" and                CZ.1.07/2.3.00/30.0039  solved  in  the  Centre  for  Research  and  Utilization  of  Renewable                 Energy and bilateral project No. 7AMB13AR008 between Czech Republic and Argentina.                  5. REFERENCES                 [1] P.G. Bruce, S.A. Freunberger, L.J. Hardwick, J.M. Tarascon, Nat. Mater., 11 (2012), p. 19                [2] X. Ji, L.F. Nazar, J. Mater. Chem., 20 (2010), p. 9821                [3] D. Aurbach, E. Pollak, R. Elazari, G. Salitra, J. Electrochem. Soc., 156 (2009), p. A694                [4] http://www.physics.rutgers.edu/Bartgroup/EnergyStorage.htm                                                                                                 39","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                     PHYSICOCHEMICAL METHODS AS A SUITABLE INSTRUMENT                                     FOR SHORT DNA FRAGMENTS STUDY                                                         1                                       Libor GURECKÝ , and Libuše TRNKOVÁ        1,2,*                 1 Department  of  Chemistry,  Faculty  of  Science,  Masaryk  University,  Kamenice  5,  CZ  –  625  00  Brno,  Czech                Republic, gurinabox@gmail.com                2                 Central  European  Institute of Technology  –  CEITEC,  University  of Technology, Technicka  10,  CZ  –  616 00                Brno, Czech Republic, *libuse@chemi.muni.cz                  Abstract                 Oligodeoxynucleotides (ODNs) are observed in the promoter region of the oncogens and of                human telomeric DNA  as  a multiple repetitive  C-  or G-  sequences. These sequences  form                                                                                                     +                tetraplex structures. C- rich ODNs form the so called i-motif, a hemiprotonated C-C  base                pairing  structures,  at  slightly  acidic  pH.  G-  rich  ODNs  form  a  G-quartet,  made  from  four                 guanines  and  stabilized  by  a  metal  kation  and  can  be  folded  into  a  G-tetraplex.  We  used                electrochemical  methods  to  study  the  behaviour  of  these  compounds  in  buffered  solutions                 with different pH, so we can comparatively evaluate the structure and fiction of each homo-                 ODN for better understanding their behaviour in solutions and on the charged interface. The                study was completed by circular dichroism spektra to confirm the structure. Results should                 provide better understanding of these compounds, so the suitable biosensor could be designed.                  1. INTRODUCTION                An  electrochemical     and  spectral  study  of  short  cytosine-  or  guanine-rich                 oligodeoxynucleotides  (ODNs)  on  a  hanging  mercury  drop  electrode  (HMDE)  in  buffered                 solutions with different pH is presented. We found out that C- or G-rich ODNs form stable                structures  at  a  slightly  acidic  pH.  Besides  the  common  electrochemical  methods,  such  as                 linear  sweep  voltammetry  (LSV)  and  cyclic  voltammetry  (CV),  in  this  study  was  used                 elimination voltammetry procedure (EVP). Spectral study consists of the absorption spectra                and circular dichroism spectra. Comparative evaluation of the structure and function of each                 homo-ODN (dCx, where x is 3-9, and y is 3, 6, 9) helps to understand the behaviour of the                studied  homo-ODN  in  solutions  and  on  charged  interface  depending  on  pH,  temperature,                 ionic strength, and chain lenght. It was discovered, that in slightly acidic buffers C-rich ODNs                form  stable  structures,  the  so-called  i-motifs,  requiring  a  partially  protonised  nucleobase,                 exept for oligo-deoxynucleotide dC3, which i stoo short to forma n i-motif structure. Guanine                                                              40","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    ODN structures have recently been paid great interest, and it was discovered, that they can                 form  multiplex  (tetraplex)  structure  via  a  g-quartet,  which  was  found  in  DNA  telomerase                repetitions and in the promoter regions of certain proto-oncogenes. Since more cimplicated                 structures  (multiplexes,  hairpins)  conditioned  by  Hoogsteen  base  pairing  in  the  ODN  with                multiple  repetitive  C-  or  G-sequences  are  often  observed  in  the  promoter  region  of  the                 oncogenes and of human telomeric DNA, such a study is significant [1-3].                  2. MATERIAL AND METHODS                 ODNs, dC 3 and dC 4 were purchased from Thermo Fisher Scientific, Ulm, Germany; dC 5, dC 6,                dC 9, dG 3, dG 6 and dG 9 from Integrated DNA Technologies, Inc., USA.                 The voltammetric experiment was performed using the electrochemical analyzer AUTOLAB                PGSTAT 20 (Ecochemie, Utrecht, The Netherlands) in connection with GPES software. The                 experimental  conditions  were  as  follows:  potential  range  from  -1  V  to  -1.7  V,  time  of                adsorption 0 s or 60 s, and scan rate from 50 mV/s to 800 mV/s.                   3. RESULTS AND DISCUSSION                From our results we figured out, that all dCx form the i-motif exept the dC3 and the stability                 of ordered structure is conditioned by pH. With rising pH we observed transition of ordered                 structures  to  unordered  structures  (confirmed  by  CD  spectroscopy)  depending  on  chain                length. This attribute also correlate when we calculate the diffusion coefficient from Randles-                 Ševčík equation.                                            Figure 1.: LSV and the elimination voltammetric procedure of dC x  at pH 6,8 (without adsorption)                                                              41","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  In G-rich ODNs we didn’t manage to find the transition midpoints due to the better stability                 of ordered structures. We assume that these structures are more resistant to pH changes and so                the further investigation in alkaline pH is needed to prove it and for helping us to find out                 better conditions for developing the biosensor.                At this point there is better chance to develop the biosensor to C-rich ODNs because of their                 large differences in behavior in buffered solutions.                                        Figure 2.: Dependence of D1/2*n3/2 on f(v) at pH 6,8                  4. CONCLUSION                 Study helps to deeply understand the different behavior of C- and G-rich ODNs in buffered                solutions and on the charged interface electrode/electrolyte and gives us useful incentives for                 next ODN investigation and provide helps for suitable biosensor designing.                  5. ACKNOWLEDGEMENT                 CEITEC – Central European Institute of Technology Project CZ.1.05/1.1.00/02.0068                NanoBiometalNet (Partnerská síť centra ecxelentního bionanotechnologického výzkumu)                 CZ.1.07/2.4.00/31.0023, MUNI/A/0992/2009 od MŠMT České Republiky                  6. REFERENCES                 [1]    Dryhurst G.: Electrochemistry of Biological Molecules, Academic Press, New York (1977).                [2]    Trnkova L., Friml J., Dracka O.: Bioelectrochemistry, 54 (2001) 131.                [3]    Trnkova L.: Jelen F., Postbieglova I.: Electroanalysis, 15 (2003) 1529-1535.                                                                 42","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                       STUDIUM FOTOCHEMICKÝCH CHRÁNÍCÍCH SKUPIN POMOCÍ                                   ČASOVĚ ROZLIŠENÉ SPEKTROSKOPIE.                   JE NANO SEKUNDA MÁLO NEBO MOC PRO ROZTRŽENÍ VAZBY?                                                     Dominik HEGER    1,2*                1                 Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5/A8, Brno 602                00, Czech Republic                 2   Research  Centre  for  Toxic  Compounds  in  the  Environment,  Faculty  of  Science,  Masaryk                University, Kamenice 3, 625 00 Brno, Czech Republic                 *hegerd@chemi.muni.cz                  Přednáška  bude  zaměřena  na  principiální  popis  fotochemických  chránících  skupin  z                 perspektivy vědeckého přínosu našeho pracovního týmu. Fotochemické chránící skupiny jsou                stále  častěji  používané  pro  mnohé  technické  a  biochemické  aplikace  jako  je  například                 litografie  či  metody  sledujících  velmi  rychlé  děje  (přenos  nervového  vzruchu). 1,  2   Tyto                aplikace  budou  ukázány  s  konkrétními  chránícími  skupinami,  jejichž  návrhy  a  zkoumání                 mechanismů  odstoupení  je  naší  vědeckou  náplní.  Rychlostní  konstanta  odstoupení  chránící                 skupiny  může  být  limitujícím  parametrem  pro  použití  pro  časově  rozlišené  studie.  Proto                budou  představeny  principy  časově  rozlišených  spektroskopických  metod  na  sub  nano                 sekundové  škále  a  ukázána  jejich  použití  při  řešení  mechanismů  odchránění  některých                                             3-5                biochemicky aktivních látek.                REFERENCES                1.     Givens,  R.  S.;  Rubina,  M.;  Wirz,  J.,  Applications  of  p-hydroxyphenacyl  (pHP)  and  coumarin-4-                 ylmethyl photoremovable protecting groups. Photochemical \& Photobiological Sciences 2012, 11, 472-488.                2.     Klan, P.; Solomek, T.; Bochet, C. G.; Blanc, A.; Givens, R.; Rubina, M.; Popik, V.; Kostikov, A.; Wirz,                J., Photoremovable Protecting Groups in Chemistry and Biology: Reaction Mechanisms and Efficacy. Chemical                Reviews 2013, 113, 119-191.                3.     Givens, R. S.; Heger, D.; Hellrung, B.; Kamdzhilov, Y.; Mac, M.; Conrad, P. G., II; Cope, E.; Lee, J. I.;                 Mata-Segreda, J. F.; Schowen, R. L.; Wirz, J., The photo-Favorskii reaction of p-hydroxyphenacyl compounds is                initiated by water-assisted, adiabatic extrusion of a triplet biradical. Journal of the American Chemical Society                2008, 130, 3307-+.                4.     Klicova, L.; Sebej, P.; Solomek, T.; Hellrung, B.; Slavicek, P.; Klan, P.; Heger, D.; Wirz, J., Adiabatic                Triplet State Tautomerization of p-Hydroxyacetophenone in Aqueous Solution. Journal of Physical Chemistry A                2012, 116, 2935-2944.                5.     Solomek, T.; Heger, D.; Ngoy, B. P.; Givens, R. S.; Klan, P., The Pivotal Role of Oxyallyl Diradicals in                Photo-Favorskii Rearrangements: Transient Spectroscopic and Computational Studies. Journal of the American                 Chemical Society 2013, 135, 15209-15215.                                                            43","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                HYALURONAN MICRO- AND NANOPARTICLES                                                                              1,2                                                           1,2                         Jana HEJNÁ   1,2* , Miloslav PEKAŘ , Filip MRAVEC , Tereza Halasová    1,2                 1 Institute of Physical and Applied chemistry, Faculty of Chemistry, Brno University of Technology, Purkyňova                118, 612 00 Brno                2                 Materials Research Center, Faculty of chemistry, Brno University of Technology, Purkyňova 118, 621 00 Brno,                Czech Republic                *xchejnaj@fch.vutbr.cz                 Abstract                 A rheological properties and particle size for two different molecular weights of hyaluronic                acid have been studied. We measured these properties depending on time, on concentration of                 hyaluronic acid and on liquid that hyaluronic acid was dissolved in. Rheological properties                and particle size independent on time. Particle size was smaller for hyaluronic acid dissolved                 in physiological solution than for hyaluronic acid dissolved in aqueous solution. Particle size                 grows depending on grows concentration of hyaluronic acid.                 1. INTRODUCTION                 Sodium (potassium) salt of hyaluronic acid (HyA) is material which occurs in human body                 (e. g. extracellular matrix, synovial fluid, vitreous humour) [1]. HyA is obtained by isolation                from natural resources (cockscomb, beef blood solution) or by isolation from Streptococcus                 bacteria. We do research on HyA as on a material suitable for drug delivery on our faculty                [2, 3]. It was decided to research properties of HyA. We measured its rheological properties in                 water solution and particle size in aqueous solution and in 0.15 M sodium chloride solution                (physiological solution). HyA occurs in wide range of molecular weight, therefore we chose                 two different molecular weights (106 kDa and 1.36 MDa).                  2. MATERIAL AND METHODS                 Material:                Sodium hyaluronan of molecular weight 106 kDa and 1.36 MDa (CPN, Lt. Dolní Dobrouč),                 sodium chloride (Lach Ner s.r.o.) and deionized water.                Methods:                                                                                                        -3                Sample preparation: Solution of HyA was prepared in concentration 0.01; 0.1 and 1 g·dm  in                aqueous solution and in physiological solution (0.15 M NaCl).                                                               44","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Viscosity  of  samples  was  measured  by  instrument  Rheometer  ARG2  (TA  Instruments).                 Viscosity  was  measured  for  two  different  molecular  weights  of  HyA  depending  on  time                (solution was measured during one week).                 Particle size of sample was measured by instrument Zetasizer Nano ZS (Malvern Instrument)                by dynamic light scattering techniques. Particle size was observed for two different molecular                 weight of HyA depending on concentration of HyA, on liquid that HyA was dissolved in and                on time (solution was measured during one week).                   3. RESULTS AND DISCUSSION                We  observed  rheological  properties  of  high  and  low  molecular  weight  HyA  depending                 on time.  We  detected  from  results  that  high  molecular  weight  of  HyA  behaves  as                non-Newtonian fluid and low molecular weight of HyA behaves as Newtonian fluid. We also                 detected that rheological properties of HyA didn´t change in our timescale.                In our work we measured particle size for two different molecular weight of HyA depending                 on time, on liquid that HyA was dissolved in and on concentration of HyA. We detected from                 results that particle size didn´t change in our timescale. Samples in physiological solution had                smaller  particle  size  compared  to  samples  of  same  concentration  in  aqueous  solution.                 The samples with the lowest concentration weren´t suitable for measuring by dynamic light                 scattering (see picture 1). Autocorrelation function doesn´t have ideal shape. Autocorrelation                function doesn´t have high value and lower part of function doesn´t decline zero. Farther you                 can see in figure 1 that particle size grows with higher concentration of HyA.                                           Figure 1.: Autocorrelation function for different concentration of HyA molecular weights of                 HyA are 1.36 MDa in physiological solution.                                                             45","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Table 1.: Particle size for HyA 1 g·dm -3                    molecular weight of HyA       solution         particle size [d. nm]                                                 aqueous     328±103  813±129  1259±169                           106 kDa                                               0.15 M NaCl     30±5    397±46  763±123                                                  aqueous     185±82  858±105  1387±288                          1,36 MDa                                               0.15 M NaCl  52±15      240±87  655±101                   4. CONCLUSION                We measured rheological properties and particle size in HyA solution.  We found out from                 rheological measure that low molecular weight  HyA behaves as Newtonian fluid, however                 high molecular weight HyA behaves as non-Newtonian fluid. During our timescale, neither                rheological properties nor particle size didn´t change in HyA solutions. Farther we found out,                 that  when  we  used  physiological  solution  as  solvent  we  detected  better  autocorrelation                function while HyA formed smaller particles independent on molecular weight HyA.                  5. ACKNOWLEDGEMENT                 This work was supported by the project “Centres for materials research at FCH BUT” No.                 CZ.1.05/2.1.00/01.0012 from ERDF.                  6. REFERENCES                [1] C. V., Hascall, C.T. Laurent, Dr.: Hyaluronan: Structure and Phyaical Properties. Glycoforum [online], 1997.                 [2]T. Halasová, J. Kroutská, F. Mravec, M. Pekař, Colloid Surface A, 391(2011), pp.25-31.                [3]T. Halasová, F. Mravec, M. Pekař, Carbohyd. Polym., 14(2013), pp. 34-37.                                                                               46","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      MIRCORHEOLOGICAL CHARACTERIZATION OF HYALURONIC                                                       ACID GELS                                                     1*                                                                            1                            Zuzana HNYLUCHOVÁ , Tereza HALASOVÁ , Miloslav PEKAŘ               1                 1                 Department of Physical Chemistry, Faculty of Chemistry, Brno University of Technology,                Purkyňova 118, 612 00 Brno, Czech Republic                *xchnyluchova@fch.vutbr.cz                  Abstract                 Particle  tracking  microrheology  as  one  of  the  passive  microrheology  methods  is  a  novel                 approach  for  determining  viscoelastic  properties  of  soft  materials.  Passive  microrehology                method is based on thermal motion of particles inserted into the investigated sample. Four                 different hyaluronic acid gels formed by mixing diverse concentrations of hyaluronic acid and                cethyltrimethylammonium bromide (CTAB) and three different sizes of probes were used to                 characterize viscoelastic response of gel microstructure characterizing by elastic G´(ω) and                viscous  G´´(ω)  moduli.    Our  measured  data  show  significant  dependence  of  viscoelastic                 properties  on  used  particle  size,  which  point  out  the  diversity  of  hyaluronic  acid  gel                 microstructure.                  1. INTRODUCTION                 Hyaluronic acid is a substance that is naturally present in the human body. It plays important                role  in  human  tissues  (main  artery,  tendon,  valve,  synovial  fluid)  where  it  serves  as  a                 connective tissue organizer and water holding substance. Because of its versatility, it is widely                used in the pharmaceutical and cosmetic industries as well as hyaluronic acid gels could be                 used for medical and cosmetic use. The more precise we know properties and characteristic of                the substance, the better and easier its following utilization in industry.                 Viscoelastic  properties  are  very  important  material  parameters  affecting  their  industrial                 applicability. The most useful method for determining such properties is classical rheology.                Nevertheless,  classical  rheology  is  not  utilizable  for  every  material  considering  relatively                 huge  amount  of  sample  (around  10 ml)  needed  for  one  measurement.  New  fast  emerging                method called microrheology has been developed for determining viscoelastic properties of                 material. As the name already suggest, the sufficient amount of sample for one measurement                several microliters.                                                               47","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIALS AND METHODS                 Particle tracking microrheology method is based on the small well defined particles embedded                into the investigated material. Size of the particles allows subjecting of the Brownian motion,                 which  depends  on  the  viscosity  of  surrounding  material  and  the  temperature  [1,2].  Mean                                                                                                     2                squared displacement (MSD or         ) relates to diffusion coefficient by equation (Δx (t)) =                2dDτ α  where d is dimension, τ is time and α is time exponent. According to the Stokes  -                 Einsten  equation  we  can  calculate  viscosity  of  material  if  the  size  of  the  particle  and                temperature is known.                  Value  of  time  exponent  α  varies  from  0      (newtonian  fluid)  to  1  (elastic  material).                 Very  important  step  is  transferring  MSD(t)  into  frequency  dependent  elastic  and  viscous                 moduli characterizing contribution of viscosity and elasticity in the sample [3,4].  Generalized                Stokes-Einstain equation is used involving Laplace-transformed quantities:                      where a is the radius of the probe sphere, η s is the Laplace transformed frequency dependent                viscosity, D(s) is the Laplace transformed frequency dependent diffusion coefficient and s is                 the Laplace frequency, from which frequency dependent shear modulus can be determined.                Samples for measurement were place into the “glass pocket” to avoid its drying or flowing                 [5].                  3. RESULTS  AND  DISCUSSION                 Four  hyaluronic  acid  gels  were  prepared  mixing  different  stock  solutions  of                cethyltrimethylammonim bromide and hyaluronic acid in the 1:1 ratio (Table 1)                  Table 1:                     Sample            Hyaluronic acid                            CTAB                                   c (w%) of stock solution             c (mM) of stock. solution                       1                     0,5                                   50                        2                     0,5                                  200                        3                     2                                     50                       4                     2                                    200                                                               48","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    From  particle  trajectories  mean-squared  displacements  (MSD)  as  a  function  of  time  were                 calculated for three different sizes of particles. Functions MSD were converted into frequency                dependent elastic and viscous moduli as you can see in Figure 1. From the graph it is obvious,                 that  moduli  are  size  particle  dependent.  Each  particle  size  reflects  structure  of  local                microenvironment based on the mesh size of the gel. The point, where elastic modulus of the                 sample  cross  the  viscous  modulus  (G´  =  G´´)  is  called  cross-over  point  and  characterizes                moment  where  the  elastic  modulus  becomes  larger  than  the  viscous  modulus.  With  the                 increasing size of particle, the cross point appears at lower value of frequency as you can see                 in the picture. Small particles detected cross-over point at the highest frequency, because in                the same sample probably they do not interact so much with the polymer structure and can                 reflect their microenvironment containing mainly solvent.  This phenomenon was observed                for every hyaluronic acid gel.                                                Figure 1.: Elastic and viscous moduli for hyaluronic acid gel 2 for trhee different sizes of                 particles                  4. CONCLUSION                 Microrheology measurements were performed on the four different hyaluronic acid gel with                the  molecular  weight  90 - 130 kDa.  It  was  observed  that  characterization  of  rheological                 properties of these gels is strongly dependent on the selected particle size, which reflects its                 microenvironment.                                                              49","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  5. ACKNOWLEDGEMENT                 The  work  has  been  supported  by  Material  Research  Centre,  Faculty  of  Chemistry,  Brno                University of Technology.                  6. REFERENCES                 [1]Bekah D.: Disertation. Ryerson University ( 2010)                [2]Cicuta P, Donald, A. M: Soft Matter. 3 (2007), 12, 1449-1455                [3]Levine A, Lubensky T. C.: Phys. Rev. Let,( 2000), 85, 1774–1777                [4]Wirtz, D: Annual Review of Biophysics 38 ( 2009), 1, 301-326                [5]Mason, T. G. et all.: Physical Review Letters, 79, 1997,17, 3282-3285                                                                                                         50","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                        DEVELOPMENT OF THE CELL SYSTEM FOR EVALUATION OF                                 ANTI-PAIIL IMMUNOGLOBULIN EFFICACY                                    1                                                                             1                                                                                                         2                                                       1                 Lucie VAŠKOVÁ , Libuše NOSKOVÁ , Barbora BLÁHOVÁ , Michaela WIMMEROVÁ ,                                                               1                                           Marie STIBOROVÁ , Petr HODEK       1*                1 Department of Biochemistry, Faculty of Science, Charles University in Prague, Hlavova 8,                   128 40 Prague 2, Czech Republic                2                 Department of Biochemistry, Faculty of Science, Masaryk University, Kamenice 753/5, 625                   00 Brno, Czech Republic                * hodek@natur.cuni.cz                 Abstract                 Using fluorescently labeled immortalized epithelium cell lines derived from normal or cystic                fibrosis  (CF)  human  lungs  the  well  plate  assay  was  set  upped.  This  assay  was  used  for                 sensoring  chicken  yolk  antibody prophylaxis  against adhesion  of  Pseudomonas aeruginosa                (PA) at a molecular level. Antibodies against PA lectin, PAIIL, significantly prevented bacteria                 adhesion  in  both  cell  lines.  In  agreement  with  in  vivo  data  our  plate  assay  showed  higher                susceptibility of CF cells to PA compared to normal epithelium.                  1. INTRODUCTION                 Cystic fibrosis (CF) is an autosomal recessive disorder caused by mutations in a single gene                coding  for  the  CF  transmembrane  conductance  regulator  (CFTR)  protein.  Resulting                 pathophysiology changes of lungs are associated with increased susceptibility of CF patients                 towards  microbial  infections.  Frequent  airway  bacterial  infections  with  pathogens  such  as                Pseudomonas  aeruginosa  (PA)  lead  to  a  progressive  lung  disease  resulting  in  chronic                 endobronchial  colonization,  which  is  connected  with  an  intense  neutrophilic  inflammatory                response. These conditions make cystic fibrosis to be one of the most common life-shortening                 genetic  disorders.  While  the  antibiotics  are  administered  to  slow  decline  in  pulmonary                function and reduce frequency and morbidity of pulmonary exacerbations, there is an urgent                 need to develop novel and effective therapies. In addition to efforts in CF gene therapy and                 corrections  of  CFTR  function,  the  antimicrobial  management,  such  as  CF  patient                immunization  against  invading  pathogens  is  being  extensively  studied.  The  concept  of                 immunization  of  CF  patients  with  vaccines  derived  from  a  PA  virulence  factor,  however,                suffers from impaired secretion of immunoglobulins at mucosal membranes of CF airways.                 Thus, the passive immunization via anti-pseudomonal immunoglobulins seems to be only a                feasible prevention of lung PA infection. In this respect chicken yolk antibodies (IgY) provide                                                               51","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  great  potential  to  become  an  efficient  tool  of  passive  immunization.  The  most  significant                 advantage  of  IgY,  in  contrast  to  mammalian  IgG,  consists  in  their  inability  to  induce                inflammatory reaction when antigen is bound. Moreover, the large production of  IgY (100                 mg/yolk) makes these antibodies well suited for prophylaxis of bacterial infections.                 2. MATERIAL AND METHODS                 Antibody preparation                 Antibodies were prepared from egg yolks laid by chickens immunized with recombinant PA                lectin,  PAIIL,  as  described  elsewhere  [1].  Pre-immune  IgY  sample  (control)  was  purified                 from eggs collected a week prior to the immunization. The presence of anti-PAIIL IgY was                determined on ELISA and Western blots using PAIIL and PA lysate as antigens, respectively.                 Bacterial adhesion assay                 NuLi  or CuFi  cells  (immortalized epithelium  cell lines  derived from  normal or CF human                lungs,  respectively,  ATCC)  were  stained  with  a  fluorescent  dye  PKH67,  seeded  onto  well                 plates  (24  wells)  and  incubated  for  24  h  at  37°C,  5%  CO 2  to  form  a  confluent  layer.  Ps.                aeruginosa  PAO1  was labeled with  a fluorescent  dye PKH26, pre-treated for 10 min with                 anti-PAIIL or control IgYs (1 mg/ml), or L-fucose, D-galactose (1% solution) or PBS, and                finally applied onto well plates. After incubation (2 hrs) non-adhered bacteria were removed                 by  extensive  washing  with  PBS.  Using  spectrofluorometer  (Tecan  Infinite  M200  Pro)  the                 adhered PA on epithelial cells were quantified (Ex 522 nm, Em 569 nm for PA; Ex 470 nm,                Em 505 nm for NuLi/CuFi). Results were expressed as a relative fluorescence ratio PA/NuLi                 or PA/CuFi.                  3. RESULTS  AND  DISCUSSION                Bacterial adherence to epithelial is an important initial step in the pathogenesis of PA. It is                 thought that airway surfaces of CF patients are lacking the sialylation of glycoconjugates such                as GM1, which enables the binding of PA [2]. As the PA lectin, PAIIL, is considered to be                 involved  in  bacteria  adhesion  on  host  cells,  we  expressed  the  recombinant  PAIIL  and                prepared chicken yolk antibodies against it. To examine the prophylactic properties of anti-                 PAIIL  IgY against the  colonization of lung  epithelial  cells  with  PA the bacterial  adhesion                 assay was developed. The experimental setup is based on the dual fluorescence determination                of PA (labeled with a dye PKH26) on epithelial cells stained with a fluorescence dye PKH67.                 The efficacy of anti-PAIIL IgY in prevention of adherence to epithelial cells was tested in                conditions ex vivo with two cell lines derived from normal (NuLi) and CF-patient (CuFi) lung                                                              52","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    tissues. The bacteria adherence is dependent on the incubation time – 2 hrs is sufficient to                 determine number of adhered PA. Figure 1 shows the prophylactic effect of anti-PAIIL IgY                (S-IgY) against the adherence of PA on CuFi/NuLi cells. While saccharide ligands D-galactose of                 PAIL and L-fucose of PAIIL failed in the protection of epithelial cells against PA adhesion, control IgY (C-IgY)                seems even to stimulate the PA binding. This unexpected effect might be attributed to agglutination of PA via                PAIIL, which binds to highly mannosylated glycoconjugates present on each heavy chain of IgY. In                 the  case  of  specific  anti-PAIIL  IgY,  the  saccharide  binding  site  of  lectin  is  blocked  by                immunoglobulin and thus excluded from the interaction with the IgY heavy chain. Prophylactic                 properties  of  anti-PAIIL  IgY  will  be  examined  further  with  experimental  animals  infected                with PA.                                 Vliv vybraných agens na adhezi bakterií na plicní buňky                        1                                                                                 NuLi-1                       0.9                                                       CuFi-1                     Relative fluorescence of PA/NuLi or CuFi  poměr rel. fluorescencí  0.7                       0.8                          0.6                       0.5                        0.4                        0.3                       0.2                       0.1                         0                                N                                            S-IgY                                UT         S-IgY        C-IgY        Gal          Fuc                                                                                  Fuc                                                                      Gal                                                        K-IgY                 Figure 1.: Effect of IgYs and saccharides on PA adhesion on epithelial cells. Cells (CuFi, NuLi) were treated                with anti-PAIIL IgY (S-IgY), control IgY (C-IgY), D-galactose (Gal), L-fucose (Fuc), or with PBS only (UT).                PA adherence is expressed as a ratio of relative fluorescences of PA vs. NuLi/CuFi.                 4. CONCLUSION                Specific chicken yolk antibodies against Ps. aeruginosa lectin PAIIL proved to be effective in                 reducing  bacteria  adhesion  on  human  airway  epithelia  cells  under  experimental  condition                 used.                5. ACKNOWLEDGEMENT                 The work has been supported by GAUK 1584814 and UNCE 204025/2012.                 6. REFERENCES                [1]Hodek P, Trefil P, Simunek J, et al.: International Journal of Electrochemical Science, 5 (2013), 113-124                [2]Bryan R, Kube D, Perez A, et al.: American Journal of Respiratory Cell and Molecular Biology, 19 (1998),                269-277                                                             53","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                           CYTOCHROME P450 1A1-CATALYZED OXIDATION OF                 CARCINOGENIC BENZO[A]PYRENE IS MODULATED BY NADH AND                                                  CYTOCHROME B                                                                         5                                   1                                                                              2                                                                                                    1*                                                            1                     Radek INDRA , Michaela MOSEROVÁ , Volker M. ARLT , Marie STIBOROVÁ                1                  Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, 128 40                Prague 2, Czech Republic                2                  Analytical  and  Environmental  Sciences  Division,  MRC-PHE  Centre  for  Environment  and  Health,                King’s College London, United Kingdom                *stiborov@natur.cuni.cz                   Abstract                Oxidation  of  benzo[a]pyrene  (BaP)  by  cytochrome  P450  (CYP)  1A1  expressed  in  a                 eukaryotic systems (microsomes, Supersomes   TM ) is stimulated by cytochrome b 5 and NADH.                In contrast, no such effects were produced by this CYP expressed in a prokaryotic system (in                 a membrane fraction of Escherichia coli cells).                 1. INTRODUCTION                Benzo[a]pyrene (BaP) has been classified as human carcinogen (Group 1) by the International                 Agency  for Research on Cancer [1]. This  is  genotoxic carcinogen  that  covalently  binds to                DNA  after  metabolic  activation  by  cytochrome  P450  (CYP)  [2].  CYP1A1  is  the  most                 important  enzyme  in  BaP  bioactivation  [2,3],  in  combination  with  microsomal  epoxide                 hydrolase  (mEH).  First,  CYP1A1  oxidizes  BaP  to  an  epoxide  that  is  then  converted  to  a                dihydrodiol by mEH (i.e. BaP-7,8-dihydrodiol); then further bio-activation by CYP1A1 leads                 to  the ultimately reactive species, BaP-7,8-dihydrodiol-9,10-epoxide (BPDE)  that can react                                                                                     2                with  DNA,  forming  adducts  preferentially  the  10-(deoxyguanosin-N -yl)-7,8,9-trihydroxy-                7,8,9,10-tetrahydrobenzo[a]pyrene adduct in vitro and in vivo [4]. BaP is, however, oxidized                also  to  other  metabolites,  such  as  the  other  dihydrodiols,  BaP-diones  and  hydroxylated                 metabolites that are mainly the detoxification products.                 The  CYP  enzyme,  including  CYP1A1,  is  a  component  of  mixed  function  oxidase  system                located in the membrane of endoplasmic reticulum that contains beside the CYPs also another                 enzyme, NADPH:cytochrome P450 reductase (POR), and cytochrome b 5  accompanied with                its NADH:cytochrome b 5 reductase. Via the activation of molecular oxygen, this multienzyme                 system  catalyzes  the monooxygenation of a variety of xenobiotics, including  BaP [5]. The                oxygen is activated in the active center of CYPs by two electrons transferred from NADPH                                                               54","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    and/or  NADH  by  means  of  POR  and  cytochrome  b 5,  respectively.  Whereas  POR  is  an                 essential constituent of the electron transport chain towards CYP, the role of cytochrome b 5 is                still  quite  enigmatic.  Likewise,  a  potential  of  NADH  as  a  donor  of  electrons  to  the  CYP-                 mediated reaction cycle is still not exactly  known. Even though the second electron in the                CYP reaction cycle might also be provided by the system of NADH:cytochrome b 5 reductase,                 cytochrome  b 5  and  NADH,  there  is  still  rather  enigmatic  whether  this  system  might                participate in donation of the first electron to CYP. Therefore, here we investigated the effect                 of cytochrome b 5 and NADH on a potency of CYP1A1 to oxidize BaP.                 2. MATERIAL AND METHODS                Liver  microsomes  of  rats,  in  which  CYP1A1  was  induced  with  Sudan  I,  Supersomes                 isolated from insect cells transfected with baculovirus constructs containing cDNA of human                 CYP1A1 and expressing POR, and human recombinant CYP1A1 expressed with its reductase                in a membrane fraction of Escherichia coli cells transfected with cDNA of human CYP1A1                 were used as model enzyme systems.                3. RESULTS  AND  DISCUSSION                 Rat hepatic microsomes, in which CYP1A1 was induced with Sudan I, oxidized BaP to eight                metabolites  separated  by  HPLC.  They  were  identified  to  be  BaP-9,10-dihydrodiol,  a                 metabolite Mx, the structure of which has  not  been identified  as  yet,  BaP-4,5-dihydrodiol,                 BaP-7,8-dihydrodiol,  BaP-1,6-dione,  BaP-3,6-dione,  BaP-9-ol  and  BaP-3-ol.  These  results                correspond to those found in earlier studies reporting that these metabolites were formed by                 CYP1A1 in combination with mEH [2]. Interestingly, the used rat hepatic microsomes formed                in  the  presence  of  NADH  the  same  BaP  metabolites  as  microsomes  with  NADPH.  The                 amounts of metabolites were also comparable.                 Human CYP1A1 expressed with POR in Supersomes  oxidized BaP to seven metabolites,                namely  BaP-9,10-dihydrodiol,  the  unknown  metabolite  Mx,  BaP-7,8-dihydrodiol,  BaP-1,6-                 dione, BaP-3,6-dione, BaP-9-ol and BaP-3-ol. This finding indicates that BaP is metabolized                not only by CYP1A1 present in this enzyme system, but also by mEH, which is important for                 the  hydration  of  BaP  epoxides  to  produce  dihydrodiols.  Therefore,  this  enzyme  has  to  be                 present  in  the  Supersomal  system.  Similar  to  hepatic  microsomes  human  recombinant                CYP1A1  expressed  with  POR  in  Supersomes    TM   oxidized  BaP  to  the  above  mentioned                 metabolites even when NADH was present instead of NADPH. Addition of cytochrome b 5 to                 the CYP1A1 system led to a more than 2-fold increase in BaP oxidation to its metabolites.                Because only the levels of individual BaP metabolites, but not of their pattern, were changed                                                               55","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  by cytochrome b 5, the effect of this protein on an electron transfer to CYP1A1 seems to be the                 predominant mechanism responsible for the observed increase in oxidation of BaP.                In contrast to supersomal CYP1A1, only five metabolites were formed by human CYP1A1                 expressed  with  POR  in  E.  coli  (Bactosomes);  the  metabolite  Mx,  BaP-1,6-dione,  BaP-3,6-                dione, BaP-9-ol and BaP-3-ol. The BaP-9-ol metabolite was formed in more than the 3.5-fold                 higher amounts in this CYP1A1 system than by CYP1A1 in Supersomes     TM . The results found                in experiments using a membrane of E. coli containing CYP1A1 and POR indicated that mEH                 seems to be present in very low concentrations that are not sufficient for catalysis of these                 reactions. Addition of cytochrome b 5 to the system of CYP1A1 expressed in E. coli led to                essentially  no  stimulation  effect  in  BaP  oxidation.  Furthermore,  in  contrast  to  CYP1A1                 expressed  in  Supersomes TM ,  no  BaP  metabolites  were  formed  by  CYP1A1  expressed  with                POR in E. coli when NADH was added instead of NADPH. However, BaP incubated ex-vivo                 with the bactosomal CYP1A1, NADH:cytochrome b 5 reductase, cytochrome b 5 and NADH                without NADPH was oxidized. The same metabolites as those formed by CYP1A1, POR and                 NADPH were formed in this system.                 4. CONCLUSION                The results found indicate that the POR-mediated electron transfer from NADPH to CYP1A1                 in the membrane of endoplasmic reticulum is stimulated by cytochrome b 5. Because of this                 effect,  cytochrome  b 5  is  a  biologically  important  factor  influencing  BaP-mediated                carcinogenesis. The results also suggest that NADH can, to some extent, substitute NADPH                 as an electron donor for the CYP1A1 reaction cycle of BaP oxidation                  5. ACKNOWLEDGEMENT                The work has been supported by  GACR (P301/10/0356) and Charles University in Prague                 (GAUK 640712 and UNCE 204025/2012).                  6. REFERENCES                 [1]IARC: IARC Monographs of Evaluation of Carcinogens. Risk of Chemicals for Human, 92 (2010), 1-853                [2]Baird WM, Hooven LA, Mahadevan B: Environmental and Molecular Mutagenesis, 45 (2005), 106–114                [3]Hamouchene H, Arlt VM, Giddings I, et al.: BMC Genomics 12 (2011), 333                [4]Phillips DH, Venitt S: International Journal of Cancer, 131 (2012), 2733-2753                [5]Coon MJ: Nutrition Review, 36 (1978), 319-328                                                                  56","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                         THE AZOBENZENE ACTINOMETER                                               1,                                                                                       1                                                                                                     4                                                                  3                     Jamaludin AL ANSHORI, * Pavel DVOŘÁK,  Roman BERÁNEK,  Jakob WIRZ,                                                      1,2                                          Petr KLÁN,  and Dominik HEGER       1,2, *                  1.  Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5/A8, 625                    00, Brno, Czech Republic.                 2.  RECETOX,  Faculty  of  Science,  Masaryk  University,  Kamenice  126/3,  625  00  Brno,                     Czech Republic.                 3.  Department  of  Physical  Electronics  -  Physics  Section,  Faculty  of  Science,  Masaryk                    University, Kotlářská 267/2, 611 37 Brno, Czech Republic.                 4.  Department  of  Chemistry,  University  of  Basel,  Klingelbergstrasse  80,  CH-4056  Basel,                    Switzerland.                    * jamaludinalanshori@gmail.com;  hegerd@chemi.muni.cz                  Abstract                Azobenzene has already been reported to be a very useful and readily available actinometer in                                                    1-4                the  spectral  range  of  254–436  nm.   It  undergoes  the  E-Z  photoisomerization  which  is  a                simple reaction, both azobenzene isomers have unique physical properties, and moreover, the                                                                                                    4                E-azobenzene  is  a  cheap,  thermally  stable,  and  recyclable  starting  material.   The                photoisomerization  of  azobenzene  has  not  only  been  utilized  in  actinometry  but  also  in                biology  to  drive  the  functional  changes  in  peptides,  proteins,  nucleic  acids,  lipids,  and                               5                carbohydrates.   To  revise  the  standard  protocol  of  the  azobenzene’s  quantum  yield  (Φ)                determination  and  find  inconsistencies  of  the  reported  molar  absorption  coefficients  of  Z-                 azobenzene, we determined the molar absorption coefficients of azobenzene isomers and the                 quantum  yields  of  the  E-Z  isomerization  with  a  higher  accuracy.  The  molar  absorption                coefficients of E-azobenzene in MeOH was calculated from the UV/Vis absorption spectra of                 various concentrations of the samples, while those of the Z-isomer were obtained using an                algebraic minimization approach from the measured UV/Vis absorption spectra of irradiated                 E-azobenzene along with the corresponding concentration ratio of the isomers obtained from                    1                the  H-NMR measurements and known molar absorption coefficients of E-azobenzene. The                quantum yield (Φ) of the Z-E isomerization in MeOH at 313 nm was found to be 0.20 ± 0.01                                                                                       6                                                                             4                which was almost two times lower than the reported one (0.30  or 0.37 ), while the quantum                yield  of  E-Z  isomerization  was  0.14  ±  0.004  which  is  in  agreement  with  that  reported  by                                                        7                                              4                Gauglitz  and  Ronayette  (0.13   or  0.14 ).  In  addition,  the  pseudo  quantum  yield  of  Z-E                isomerization in MeOH at 313 nm was calculated to be 3588 ± 27.                                                               57","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  REFERENCES                 (1)    Zimmerman, G.; Chow, L. Y.; Paik, U. J. J. Am. Chem. Soc. 1958, 80, 3528.                (2)    Marco Montalti, A. C., Luca Prodi, M. Teresa Gandolfi  Handbook of Photochemistry; 3rd ed.; CRC                 Press Taylor \& Francis Group: Boca Raton, 2006.                (3)    Leighton, W. G.; Forbes, G. S. J. Am. Chem. Soc. 1930, 52, 3139.                (4)    Gauglitz, G.; Hubig, S. J. Photochemistry 1985, 30, 121.                (5)    Beharry, A. A.; Woolley, G. A. Chem. Soc. Rev. 2011, 40, 4422.                (6)    Siampiringue, N.; Guyot, G.; Monti, S.; Bortolus, P. J. Photochem. 1987, 37, 185.                (7)    Ronayette, J.; Arnaud, R.; Lebourgeois, P.; Lemaire, J. Can. J. Chem. 1974, 52, 1848.                                                                                                      58","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                         DEEPER RESEARCH OF STRUCTURAL CHANGES OF HUMIC                             ACIDS USING LIGHT SCATTERING TECHNIQUES                                               *                              Michal KALINA , Aneta CHYTILOVÁ, Martina KLUČÁKOVÁ                Materials  Research  Center,  Faculty  of  Chemistry,  Brno  University  of  Technology,                Purkyňova1464/118, 612 00 Brno, Czech Republic                    *xckalina@fch.vutbr.cz                  Abstract                Humic acids are remarkable substance, which significantly participate in natural processes.                 For structural modelling and also for their possible future application parameters as particle                 size and conformation seem to be essential. This contribution is dealing with study of both                these parameters measured by means of dynamic light scattering method. The main aim of the                 work was the study of behavior of lignite humic acids in their aqueous dispersions. The effect                of  pH,  purification  and  selective  modification  is  during  the  work  discussed.  All  these                 parameters significantly influence behavior of humic acids in aqueous solutions by impacting                on their supramolecular stabilization and their aggregation processes.                   1. INTRODUCTION                Humic  acids  are  remarkable  natural  compounds,  which  play  a significant  role  in  binding,                 transport and biological  uptake of different nutrients and contaminants in soils and aquatic                 environments.  The main function of humic  acids (HA) in  soils  and sediments  is  to  impact                the porosity and to  act  as a sorbent  and reservoir of water and different  kind  of chemicals.                 Well–known and described is high affinity of HA toward different species such as metals,                surfactants, dyes and hydrophobic species [1, 2, 3, 4]. These facts hand by hand with humic                 acids  colloidal  size,  rich  natural  availability  and  relatively  low–cost  extraction  techniques                create from them extremely important material for practical applications. For basic structural                 modelling,  study  of  reactivity  and  possible  future  applications  of  humic  acids  basic                 parameters such as particle size and shape as well as molecular weight must be taken into                account. Light scattering techniques can provide easy methods, which can be applied for such                 characterization  [5].  Application  of  light  scattering  methods  in  the  area  of  humic  particle                characterization  upraises  recent  years  as  novel  techniques.  This  area  of  research  is  still                 encountered by few experimental difficulties mainly caused because of the heterogenic and                polydisperse character of humic materials.                                                               59","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIAL AND METHODS                 Humic acids, studied in this work, were obtained in the process of alkaline extraction from                South Moravian lignite. More details on the method of isolation of humic acids as well on                 the characterization can be found in [2, 4, 6]. Obtained humic acids were repeatedly washed                in water and freeze dried to decrease the content of inorganic salts.                 For  study  of  the  aggregation  processes  of  humic  acids  in  aqueous  solutions  two  different                groups  of  humic  sols  were  prepared.  The  first  group  (SOL  A  and  B)  was  represented  by                 samples prepared by direct dissolving of solid humic acids in 0.1 M NaOH (SOL A). SOL B                 contained of solid humic acids dispersed in water (followed by adjusting of pH to value 12                using 5 M NaOH). The second group can be described as neutral sols of HA. SOL C was                 prepared by neutralization of solution of HA in 0.1 M NaOH using 0.1 M HCl (volume ration                of 0.1 M NaOH to 0.1 M HCl was 1:1). The second type of neutral humic sol was prepared by                 diluting of most concentrated SOL A using 0.1 M NaCl. Final concentrations of HA in all                                                                                                −3                utilized sols were following: 0.01; 0.02; 0.1; 0.2; 0.5; 1; 1.5; 2; 4; 5; 6 and 10 g·dm .                To study the influence of often utilized selective blocking (methylation) of functional groups                 (mainly carboxylic and phenolic) of HA washed samples were treated with methylation agent.                For these purposes TMS-N2 (trimethylsilyl diazomethane) was used. More details about this                 process  can  be  found  in  [4].  Success  of  the  methylation  process  was  verified  using  FTIR                 spectroscopy.  FTIR  spectra  of  solid  humic  powders  in  KBr  pellets  were  measured  using                spectrometer Nicolet iS50.                 Particle size distribution for all studied humic acids dispersion were obtained using Zetasizer                Nano  ZS  system  from  Malvern  Instrument  by  means  of  the  method  of  dynamic  light                 scattering.  Obtained  size  distributions  represent  valuable  tool  for  characterization  of  the                aggregation  processes  in  humic  acids  solutions  and  for  comparison  of  different  sources  of                 humic acids, different humic conditions of preparation of humic sols and also pre–treatment.                 All presented size distribution represent average values from five repeated measurements. The                measurements were carried out at temperature (25.0±0.1) °C.                  3. RESULTS AND DISCUSSION                 The main part of this work was dealing with the utilization of dynamic light scattering for                basic particle characterization of different humic dispersions. The basic output from dynamic                 light  scattering  method  is  intensity  size  distribution,  which  shows  dependence  of  relative                 intensity of scattered light on distribution of particle size classes. Intensity size distribution                can be converted, using mathematical algorithm called Mie theory, to a volume distribution.                                                             60","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    The volume distribution describes more clearly the distribution of mass in the sample. First                 part of the work was investigating the effect of purification of HA on obtained particle size                distributions. Figure 1A describes the volume particle distribution of SOL A after different                 purification steps. This pre–treatment of HA significantly decreased their content of ash from                30.5 weight  %  to  26.6 weight  %  after  repeated  washing  respectively  to  2 weight  %  after                 applying  of  freeze–drying.  From  Figure  1A  is  obvious  that  decreased  level  of  ash  in  the                sample decrease also the process of aggregation of HA. By these reasons the freeze-dried HA                 were used as source material for preparation of all the humic dispersions in this work.                                         Figure 1.: A) Volume particle size distributions of lignite HA after different pre-treating steps                – lignite HA in 0.1 M NaOH (SOL A - green line), washed HA in 0.1 M NaOH (blue line)                 and freeze-dried HA in 0.1 M NaOH (red line) and lignite HA dissolved in water (SOL B –                black line); B) Volume particle size distributions of lignite HA in mixture of 0.1 M NaOH +                 0.1 M HCl (SOL C – purple line) and lignite HA in 0.1 M NaCl (SOL D – orange line).                  Figure 1A illustrates the comparison of HA dissolved in 0.1M NaOH (SOL A) and in water                 (SOL B).  Both  these  alkali  groups  of  dispersions  show  three  different  parts  in  their                distributions. First region is up to 100 nm, which can be defined as single humic particles. The                 peaks  round  400 nm  can  be  assigned  to  supramolecular  assemblies  of  humic  particles                stabilized by non-covalent interactions. The last part of the distributions above 2000 nm can                 be  described  as  aggregates  of  molecules.  These  findings  are  consistent  with  new                 supramolecular  models  of  HA  structure  [7].  Figure  1B  describe  the volume  particle  size                distributions of neutral HA dispersions (SOL C and SOL D). The different way of preparation                 and  mainly  the  different  pH  of  the  dispersions  significantly  influenced  the  particle                distributions. The particle distribution of SOL C shows that decrease of pH of the solutions                                                              61","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  caused by its neutralization destroyed the non–covalent stabilization of humic supramolecular                                                                                                         −                                                                                                    +                assemblies. On the other side SOL D contained high level of low–molecular ions (Na , Cl ),                which  significantly  decreased  stability  of  these  HA  dispersions  and  aggregation  of  HA                 particles occurred.                                     Figure 2.: A) Infrared spectra of lignite humic acids (red) and their methylated forms (black)                B)  Volume  particle  size  distribution  of  lignite  humic  acids  (red)  and  their  methylated                 equivalent (black)                  The last part of the work was  investigating the  effect  of selective modification of reactive                 functional groups of HA in the process of selective methylation using TMS-N2 [4]. The FT-                IR  spectra  of  HA  and  MHA  (Figure  2A)  confirmed  the  modification  of  humic  acids  after                 methylation. On the other side Figure 2B displayed that the methylation process of HA did                not  increase  significantly  their  aggregation.  The  only  difference  in  obtained  particle  size                 distributions can be found in the area round 1000 nm, which can be connected to change of                 the conformation of HA in the solutions.                  4. CONCLUSION                The results of this study shed new light on behavior of humic acids in aqueous solutions. The                 work emphasized the purification as important pre–treatment step for humic acids to decrease                 their  aggregation.  Obtained  data  confirmed  the  supramolecular  model  of  humic  acids                structure. On the other side the effect of pH and content of low molecular ions has to be also                 taken  into  mind.  Both  these  parameters  significantly  influence  humic  acids  behavior  in                aqueous solutions.                                                                  62","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    5. ACKNOWLEDGEMENT                 This work has been supported by Materials Research Centre at FCH BUT- Sustainability and                Development, REG LO1211, with financial support from National Program for Sustainability                 I (Ministry of Education, Youth and Sports)                  6. REFERENCES                [1]Tipping E: Cation Binding by Humic Substances, (2002), 434 p.                [2]Sedlaček P, Smilek J, Klučáková M: Reactive and Functional Polymers, 7, (2013), 1500-1509.                 [3]Ishiguro M, Tan W, Koopa, L K: Colloids and Surface A: Physicoch,. and Eng. Aspects, 306 (2007), 29-39.                [4]Klučáková M, Kalina M, Sedláček P:  Journal of Soils and Sediments, 14 (2014), 368-376.                [5]Brown W: Dynamic light scattering: The Method and Some Applications, (2011), 752 p.                [6]Peuravuori J, Žbanková P, Pihlaja K: Fuel Processing Technology, 87 (2006), 9, 829-839.                [7]Piccolo A, Nardi S, Concheri G: Chemosphere, 4 (1996), 33, 595-602.                                                                                                63","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                   ARE FLAVONOIDS FENOXIDE ANIONS BETTER HYDROGEN ATOM                                    DONORS THAN PARENT MOLECULES?                            Ján RIMARČÍK, Erika SENAJOVÁ, Adam VAGÁNEK, Erik KLEIN*                    Institute  of  Physical  Chemistry  and  Chemical  Physics,  Faculty  of  Chemical  and  Food                   Technology,  Slovak  University  of  Technology  in  Bratislava,  Radlinského  9,  SK-812  37                    Bratislava, Slovakia                   *erik.klein@stuba.sk                  Abstract                 In this work, we have theoretically studied the thermodynamics of the O–H bonds homolytic                 cleavage in various fenoxide anions formed from quercetin and kaempferol in the terms of                corresponding BDEs.                  1. INTRODUCTION                 Flavonoids represent a large class of naturally occurring polyphenols, mainly found in fruits,                 vegetables and cereals. Growing interest in flavonoids research can be attributed mainly to the                 antioxidant and free radical scavenging activities related to their OH groups [1], Fig. 1.                                                                    3'                                                                2'      4'                                                      8    O        B                                                  7           2          5'                                                     A     C        6'                                                  6             3                                                      5     4                Figure 1: Atom numbering and ring denotation in flavonoids.                                                                           –                Experimental  works  indicate  that  phenoxide  anions, ArO ,  formed  from  flavonoids  can  be                better  radical  scavengers  than  neutral  molecules, ArOH  [2–4].  Therefore,  in  this  work  we                 decided to study the thermodynamics of the hydrogen atom transfer (HAT) from the fenoxide                anions of quercetin and kaempferol (Fig. 2) in three environments: gas-phase, benzene, and                                                                                                         –                water. Homolytic OH group splitting-off leading to the formation of the radical anion ArO  is                driven by O–H bond dissociation enthalpy, BDE.                 2. COMPUTATIONAL DETAILS                 All calculations were performed using Gaussian 09 program package [5]. The geometries of                 all  species  were  optimized  using  DFT  method  with  B3LYP  [6]  functional  without  any                                                             64","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                                                                             −1                                                         −1                                                −5                constraints (energy cut-off of 10  kJ mol , final RMS energy gradient under 0.01 kJ mol                  −1                Å ). Calculations were performed in 6-311++G** basis set [7]. Solvent contribution to the                total enthalpies was computed using integral equation formalism IEF-PCM method [8, 9].                                                    OH                                                         OH                               OH                               H O          O                   H O          O                                                   OH                               OH                                     OH    O      quercetin           OH    O      kaempferol                Figure 2: Parent molecules ArOH.                  3. RESULTS AND DISCUSSION                  For chosen anions, BDE values calculated for T = 298 K are compiled in the Table 1. The first                column shows splitted-off OH group, second column presents the reacting anion. First row of                 each table section shows BDEs for the neutral parent molecule.                                                                      –1                Table 1: B3LYP/6-311++G** BDE values in kJ mol .                    –                              –                ArO       ArO                quercetin                      kaempferol                                    gas      benzene    water          gas     benzene   water                3’-OH    ––         316       324       316                            –                         4’-O       326       324       302                            –                         3-O        257       272       279                            –                         5-O        281       301       306                            –                         7-O        286       306       308                4’-OH    ––         305       313       305            338      343     331                            –                         3’-O       299       303       287                            –                         3-O        224       242       251            249      265     271                            –                         5-O        257       279       288            282      303     311                            –                         7-O        260       283       290            284      306     313                3-OH     ––         339       338       317            340      340     318                            –                         3’-O       295       304       296                            –                         4’-O       290       295       283            290      295     284                            –                         5-O        328       328       307            334      323     308                            –                         7-O        311       315       300            310      315     300                7-OH     ––         362       366       351            360      365     352                            –                         3’-O       284       303       304                            –                         4’-O       285       300       300            285      302     304                            –                         3-O        271       280       278            271      280     279                            –                         5-O        315       327       326            309      323     324                                                             65","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  For  all  anions  (with  the  exception  of  3’,4’-  radical  anion  of  quercetin  in  gas-phase  and                                          –                benzene),  HAT  from  ArO   shows  lower  BDE  in  the  comparison  to  the  parent  molecules.                                                                –1                Differences are often in order of tens of kJ mol . For both flavonols, the lowest BDEs are                                                             –                attributed to 4’-OH group splitting-off in 3-O  fenoxide anions. For the majority of formed                                                              –                radical anions, lowest BDEs are related to 3-O  fenoxide anions. For HAT running at 3-OH                                                             –                group, the lowest BDE was obtained for 4’-O  fenoxide anion. However, we should note that                reaction  enthalpies  of  the  deprotonation  of  individual  OH  groups  in  parent  molecules  are                 different and dramatically depend on the environment [10]. Thus, to find the lowest overall                                                                        –                reaction enthalpy for the formation of radical anion ArO  from the parent ArOH molecule the                sum of the reaction enthalpies of the two steps (deprotonation and HAT) has to be taken into                 account.                  4. CONCLUSION                 In the gas-phase, benzene and water, we have confirmed that all OH groups present in the                                     –                fenoxide anions ArO  formed from quercetin and kaempferol are, from the thermodynamic                point of view, actually better hydrogen atom donors than the parent molecules.                   5. ACKNOWLEDGEMENT                This  work  has  been  supported  by  the  Slovak  Grant  Agency  (VEGA  1/0735/13  and                 1/0307/14).                  6. REFERENCES                 [1]  Procházková D, Boušová I, Wilhelmová N: Fitoterapia 82 (2011), 513–523                [2]  Musialik M, Kuzmicz R, Pawlowski TS, Litwinienko G: J. Org. Chem. 74 (2009), 2699–2709                [3]  Jovanovic SV, Steenken S, Tosic M, Marjanovic M, Simic MG: J. Am. Chem. Soc. 116 (1994), 4846–4851                [4]  Lemanska K, et al.: Free Radic. Biol. Med. 31 (2001), 869–881                [5]  Frisch MJ, et al. Gaussian 09, Revision C.01, Gaussian, Inc., Wallingford, CT, 2010                 [6]  Becke A: J. Chem. Phys. 98 (1993), 5648–5652                [7]  Binkley JS, Pople JA, Hehre WJ: J. Am. Chem. Soc. 102 (1980), 939–947                [8]  Cances E, Mennucci B, Tomasi J: J. Chem. Phys. 107 (1997), 3032–3041                [9]  Cances E, Mennucci B: J. Math. Chem. 23 (1998), 309–326                [10]  Vagánek A, Rimarčík J, Lukeš V, Klein E: Comput. Theor. Chem. 991 (2012), 192–200                                                                  66","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                     ON THE HOMOLYTIC AND HETEROLYTIC O–H BOND CLEAVAGE                                                    IN VITAMIN B6                         Peter ŠKORŇA, Ján RIMARČÍK, Michaela KLENOVIČOVÁ, Erik KLEIN*                     Institute  of  Physical  Chemistry  and  Chemical  Physics,  Faculty  of  Chemical  and  Food                    Technology,  Slovak  University  of  Technology  in  Bratislava,  Radlinského  9,  SK-812  37                   Bratislava, Slovakia                    *erik.klein@stuba.sk                  Abstract                 This work is focused on the thermodynamic study of  the reaction enthalpies related to the                three mechanisms of primary antioxidants action of the three vitamin B6 components, as well                 as 4-pyridoxic acid that represents their metabolite.                  1. INTRODUCTION                 Current experimental research results indicate that vitamin B6, Fig. 1, shows an antioxidant                                                                        1                activity in plants [1]. It is more powerful singlet oxygen,  O 2, scavenger than vitamins C and                E [2]. In blood, it shows higher antioxidant activity than vitamin C [3], too.                                                 N     CH 3                  N     CH 3                                      HOCH             OH         HOCH             OH                                         2                            2                                               CH NH 2   (a)               CH OH     (b)                                                  2                                                                              2                                               N     CH 3                  N     CH 3                                     HOCH              OH         HOCH             OH                                         2                            2                                               CHO       (c)               COOH      (d)                 Figure 1: Vitamin B6: pyridoxamine (a), pyridoxine (b), pyridoxal (c); 4-pyridoxic acid (d).                  In this work we decided to study the reaction enthalpies related to the three mechanisms of                 primary antioxidants action for pyridoxamine, pyridoxine, pyridoxal, and 4-pyridoxic acid in                three  environments:  gas-phase,  benzene,  and  water.  Antioxidant  action  of  investigated                 compounds can be ascribed to the OH group attached directly to the aromatic ring, placed in                 the meta position to nitrogen. One of the aims of the work is to compare calculated reaction                                                             67","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  enthalpies with data available for typical primary phenolic antioxidants, such as tocopherols                 or flavonoids.                  2. COMPUTATIONAL DETAILS                 All calculations were performed using Gaussian 09 program package [4]. The geometries of                all studied species were optimized using DFT method with B3LYP [5] functional without any                                                −5                                                         −1                                                                                                         −1                constraints (energy cut-off of 10  kJ mol , final RMS energy gradient under 0.01 kJ mol                  −1                Å ). Calculations were performed in 6-311++G** basis set [6]. Solvent contribution to the                total  enthalpies  was  computed  using  integral  equation  formalism  IEF-PCM  method  [7,  8].                From  the  total  enthalpies,  following  reaction  enthalpies  were  calculated  for  the  above                 mentioned reaction centre: (i) O–H bond dissociation enthalpies; (ii) ionization potentials and                 (iii)  proton  dissociation  enthalpies;  (iv)  proton  affinities  of  anions  formed  by  OH  group                deprotonation  and  (v)  electron  transfer  enthalpies  (for  the  definitions,  see  ref.  [9])  at                 T = 298 K.                  3. RESULTS AND DISCUSSION                 In all environments, bond dissociation enthalpies, BDE, reached similar values. In the gas-                                                     –1                phase, they lie in the 346–400 kJ mol  range. The lowest value was found for pyridoxamine                                                                                           –1                and pyridoxine (difference between the corresponding values only 1 kJ mol ). The highest                                                                                                –1                                                                  –1                BDEs were found for 4-pyridoxic acid (390 kJ mol ) and pyridoxal (400 kJ mol ), because                CHO  and  COOH  groups  form  strong  intramolecular  hydrogen  bonds  with  the  OH  group                 representing the reaction center. The lowest ionization potential and electron transfer enthalpy                values were found for pyridoxamine. On the contrary, lowest proton dissociation enthalpies in                 all studied environments were obtained for  4-pyridoxic acid. Lowest proton affinities were                 found for pyridoxine. In solution-phase, reaction enthalpies for processes including charged                species  are  significantly  lower  than  corresponding  gas-phase  values.  In  general,  found                 reaction  enthalpies  are  similar  to  those  found  for  phenolic  antioxidants  –  tocopherols  or                 flavonoids [9].                Currently,  obtained  results  are  analyzed  in  order  to  (i)  identify  the  effect  of  –CH 2NH 2,                 – CH 2OH, –CHO, and –COOH groups in the para position to nitrogen atom (Fig. 1) on the                studied reaction enthalpies, and (ii) to assess the role of the environment.                                                                  68","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    4. CONCLUSION                 In  this  ongoing  theoretical  work,  we  study  pyridoxamine,  pyridoxine,  pyridoxal,  and  4-                pyridoxic acid in the various environments with the focus on the thermodynamics of aromatic                 OH group homolytic and heterolytic splitting-off. Calculated reaction enthalpies are analyzed                to shed light on the effect of the substituent located in the para position to nitrogen atom.                   5. ACKNOWLEDGEMENT                This  work  has  been  supported  by  the  Slovak  Grant  Agency  (VEGA  1/0735/13  and                 1/0307/14).                  6. REFERENCES                 [1]  Denslow A S, Walls AA, Daub, EM: Physiol. Mol. Plant. P. 66 (2005), 248–249                [2]  Bilski P, Li YM, Ehrenshaft M, Daub EM, Chignell FC: Photochem. Photobiol. 71 (2000), 129–134                [3]  Stocker P, Lesgards J-F, Vidal N, Chalier F, Prost M: Biochim. Biophys. Acta 1621 (2003), 1–8                [4]  Frisch MJ, et al. Gaussian 09, Revision C.01, Gaussian, Inc., Wallingford, CT, 2010                [5]  Becke A: J. Chem. Phys. 98 (1993), 5648–5652                [6]  Binkley JS, Pople JA, Hehre WJ: J. Am. Chem. Soc. 102 (1980), 939–947                 [7]  Cances E, Mennucci B, Tomasi J: J. Chem. Phys. 107 (1997), 3032–3041                [8]  Cances E, Mennucci B: J. Math. Chem. 23 (1998), 309–326                [9]  Vagánek A, Rimarčík J, Lukeš V, Klein E: Comput. Theor. Chem. 991 (2012), 192–200                                                                                    69","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                        Observation of prompt ISC from higher excited states of the anion                                               of p-hydroxyacetophenone                                1*)                                                 1)                                                                                           2)                                                                     1)                  J. Krausko , J. A. Anshori , M. Chrástková , D. Nachtigallová , D. Heger               1)                 1 Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5/A8, Brno 602                 00, Czech Republic; Research Centre for Toxic Compounds in the Environment, Faculty of                Science, Masaryk University, Kamenice 3, 625 00 Brno, Czech Republi                2                 Institute of Organic Chemistry and Biochemistry, Flemingovo nam. 2, 166 10 Prague, Czech                Republic.                 *krausko@mail.muni.cz                  Phenacyl compounds are promising candidates for use as photoremovable protecting groups                 (PPGs) enabling spatial and temporal control over the release of various molecules of interest                (neurotransmitters,  drugs,  etc.)   [1] .  However,  detailed  knowledge  of  their  photophysics  is                 needed.                                                            –                The  anion  of  p-hydroxyacetophenone  (pHA )  was  reported  by  us  and  others  not  to  give  a                triplet state upon the excitation at the red edge of its absorption spectrum (355 nm) whereas                 excitation  at  lower  wavelengths  produced  triplet  effectively [2,3,4] .  This  observation  is                thoroughly  demonstrated  by  luminescence  and  LFP  experiments  which  bring  us  to  the                 explanation that is underlined by quantum chemical calculations. The S1 state is giving only                the fluorescence, while the S2 is more effectively ISC to the T2 than IC to S1.                  [1] P. Klán, T.Šolomek, et al., Chem. Rev. 2013, 113 (1), 119–191.                 [2] Ľ. Klíčová, P. Šebej, et al., The Journal of Physical Chemistry A 2012, 116, 2935-2944.                [3] P. Zuo, C. S. Ma, et al., J. Org. Chem. 2005, 70, 8661-8675.                [4] V. B. Kammath, T. Šolomek,  B. P. Ngoy, D. Heger, P. Klán, M. Rubina, R. S. Givens, Journal of Organic                Chemistry 2013, 78, 1718                                                                        70","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                        ACIDITY OF FROZEN SOLUTIONS AND ITS CONNECTION TO                              DEGRADATION OF ENZYMES UPON FREEZING                                                               1                                                                                 1                                          1                                                                                                 1                         Ľubica Krausková , Jitka Procházková , Martina Klašková , Václav Hutník ,                                                                          1,2                                                        1,2                                               Petr Klán , Dominik Heger                1                 Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5/A8, Brno 602                00, Czech Republic               2   Research  Centre  for  Toxic  Compounds  in  the  Environment,  Faculty  of  Science,  Masaryk                University, Kamenice 3, 625 00 Brno, Czech Republic                   When  a  buffered  solution  is  frozen,  its  acidity  may  change  considerably  due  to  sequential                crystallization  of  individual  buffer  components,  as  was  shown  for  sodium  phosphate  and                 succinate  buffer  systems  [1,  2].  For  example,  when  sodium  phosphate  buffer  is  frozen,                Na 2HPO 4  starts  to  precipitate,  leaving  only  NaH 2PO 4  in  the  remaining  solution  and  a  pH                 decreases as much as 3 pH units [3]. Such an abrupt pH change can affect stability of proteins                and other biomolecules during the process of freezing.                        Addition of neutral salts to a solution prior to freezing also affects pH of the frozen                 solution. Cations and anions are not incorporated into the ice lattice equally; it leads to charge                imbalance  between  the  ice  and  the  unfrozen  solution  and  Workman-Reynolds  freezing                 potential is generated. The excess charges are eventually neutralized via interfacial transport                     +                            −                of  H   /  OH   ions  and  the  acidity  of  the  remaining  solution  can  change  significantly  and                permanently [4, 5].                        We  applied  UV-Vis  absorption  and  diffuse  reflectance  spectroscopy  to  measure                acidities of frozen aqueous solutions of common buffers and salts under various conditions. A                 low amount of acid-base indicator cresol red was used as an internal probe [6]. The observed                pH changes and their consequences for enzymes freezing and thawing will be discussed in the                 presentation.                  REFERENCES                1.     Murase,  N.  and  F.  Franks,  Salt  Precipitation  During  the  Freeze-Concentration  of  Phosphate  Buffer                Solutions. Biophysical Chemistry, 1989. 34(3): p. 293-300.                2.     Sundaramurthi, P., E. Shalaev, and R. Suryanarayanan, Calorimetric and Diffractometric Evidence for                 the  Sequential  Crystallization  of  Buffer  Components  and  the  Consequential  pH  Swing  in  Frozen  Solutions.                Journal of Physical Chemistry B, 2010. 114(14): p. 4915-4923.                                                               71","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  3.     Gomez, G., M.J. Pikal, and N. Rodriguez-Hornedo, Effect of initial buffer composition on pH changes                during  far-from-equilibrium  freezing  of  sodium  phosphate  buffer  solutions.  Pharmaceutical  Research,  2001.                18(1): p. 90-97.                4.     Workman,  E.J.  and  S.E.  Reynolds,  Electrical  Phenomena  Occurring  during  the  Freezing  of  Dilute                 Aqueous Solutions and Their Possible Relationship to Thunderstorm Electricity. Physical Review, 1950. 78(3):                p. 254.                5.     Bronshteyn, V.L. and A.A. Chernov, Freezing Potentials Arising on Solidification of Dilute Aqueous-                Solutions of Electrolytes. Journal of Crystal Growth, 1991. 112(1): p. 129-145.                6.     Heger, D., J. Klanova, and P. Klan, Enhanced protonation of cresol red in acidic aqueous solutions caused                by freezing. Journal of Physical Chemistry B, 2006. 110(3): p. 1277-1287.                                                                                                  72","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    STUDY OF NANOPARTICLES FORMED BY NEGATIVELY CHARGED                                 HYALUROAN AND CATIONIC SURFACTANT                                                               1*                                         Tereza KRUTIŠOVÁ , Miloslav PEKAŘ        1                 1                 Brno University of Technology, Faculty of Chemistry, Institute of Physical and Applied                Chemistry, Purkyňova 464/118, 612 00 Brno, Czech Republic                *xckrutisova@fch.vutbr.cz                  Abstract                 Negatively charged hyaluronan binds to cationic surfactant via electrostatic interactions which                 result  in  self-assembly  nanoparticles  formation.  These  particles  have  a  core-shell  like                structure  and  can  be  used  in  targeted  drug  delivery  of  hydrophobic  active  substances.  A                 hydrophobic  inner  core  contains  aggregated  surfactant  molecules  and  hyaluronan  creates  a                hydrophilic shell layers.                 The  aim  of  our  study  was  to  prepare  and  study  hyaluronic  acid  nanoparticles  based  on                electrostatic interactions with oppositely charged surfactant molecules.                 Interactions of hyaluronan and surfactants were investigated using dynamic light scattering                 and  Laser  Doppler  Velocimetry  methods.  Titration  experiments  (size  distribution  and  zeta                potential  measurements  and  isoelectric  point)  were  utilized  to  explore  the  formation  of                 aggregates. Hyaluronan or surfactant was used as titrant for comparison of two preparation                 methods of these systems. Effect of molecular weight and concentration of hyaluronan were                investigated.                 Aggregates formation is influenced by preparation of systems. Different types of particles are                formed if hyaluronan is added to surfactant solution or vice versa. If hyaluronan have a role of                 titrant,  final  particles  are  smaller  than  in  the  case  of  surfactant  as  titrant  and  can  be  more                suitable for drug delivery applications.                 Assuming  in  the  isoelectric  point  is  reached  compensation  of  charges  of  hyaluronan  and                 surfactant,  real  degrees  of  hyaluronan  dissociation  were  determined.  Concentration  of                hyaluronan  and  conformation  of  hyaluronan  in  the  system  have  a  significant  effect  on                 established degree of dissociation.                                                                  73","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  1. INTRODUCTION                 Hyaluronan  is  a  naturally  occurring  linear  polysaccharide.  It  is  a  negatively  charged                biopolymer possessing one carboxylate group per disaccharide repeating unit (D-glucuronic                 acid and N-acetyl-D-glucosamine residues linked by β(1-4) and β(1-3) bonds). Hyaluronan                can be found primarily in the extracellular matrix of all higher organisms, and is therefore an                 attractive building block for new biocompatible and biodegradable materials that could have                applications in drug delivery, tissue engineering, wound healing or surgery [1].                 Hyaluronan cannot be directly used to carry nonpolar substances (hydrophobic drugs e.g. for                 fighting  cancer)  due  to  its  highly  hydrophilic  character  and  large  hydration  shell.  A                combination of hyaluronan with surfactant may lead to formation of associates in which the                 surfactant  hydrophobic  domains  solubilize  hydrophobic  substances  and  hyaluronan  plays  a                role of biocompatible carrier and targeting agent [2].                 Complex formation is influenced by preparation of systems. Different types of particles are                formed if hyaluronan is added to surfactant solution or vice versa. In the case of surfactant as                 titrant as the ratio of surfactant molecules to charged sites on the polyelectrolyte approaches                 unity, precipitation of the complex occurs due to charge neutralization of the polyelectrolyte                and to the hydrophobic nature of the bound surfactants, which adopt a conformation in which                 their  ionic  headgroups  are  effectively  removed  from  the  solution.  On  addition  of  further                 surfactant, the insoluble polymer-surfactant complex redissolves. This is due to cooperative                binding  of  surfactant  molecules  on  the  polymer  chains,  whereby  hydrophilic  micelles  are                 formed  [3].  Formation  of  hyaluronan-surfactant  complex  nanoparticles  can  be  done  by                addition  of  hyaluronan  to  surfactant  solution.  It  is  necessary  use  surfactant  concentration                 under a critical micelle concentration to presence of micelles aggregates in solution.                Dynamic light scattering method and zeta potential measuremtns is one of many techniques                 for study of polyelectrolyte-surfactant interaction [4]. Results confirmed that these systems                 are formed due to electrostatic interactions and it depends on molar ratio of components.                  2. MATERIAL AND METHODS                Hyaluronan (as sodium salt of hyaluronic acid; HyA) was purchased from CPN, Ltd., Czech                 Republic. Cationic surfactant cetyltrimethylammonium bromide (CTAB) of the best available                purity was purchased from Sigma-Aldrich, Czech Republic.                 Stock  solutions  of  hyaluronan  and  CTAB  were  prepared  in  aqueous  solution.  All  stock                 solution  were  prepared  by  slow  dissolution  of  powdered  substances  upon  stirring  and  left                stirred for 24 hours to ensure complete dissolution.                                                             74","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Titrations of substances were performed for investigation of interactions between hyaluronan                 and surfactant. Surfactant or hyaluronan was used as titrant. Isoelectric points (point of zero                charge) were determined and compared. In the case of surfactant as titrant, concentration of                                                                                                  -1                                                                                                         -1                surfactant titrant  was 5 mM  or 50 mM  and hyaluronan concentration was  15 mg·l , 1 g·l ,                respectively. In the case of hyaluronan as titrant, concentration of hyaluronan titrant was 1 g·l -                 1  and surfactant concentration was 1 mM. Hyaluronan was used at two molecular weights,                116 kDa and 1669 kDa.                 Finally colloids were characterized by dynamic light scattering and laser Doppler Velocimetry                 methods.  Size  distribution  (correlation  function)  and  zeta  potential  measurements  were                utilized  to  explore  the  formation  of  complex  micelles.  All  measurements  were  performed                 using  Zetasizer  Nano ZS  (Malvern  Instruments).  All  Zetasizer  units  provide  a  z-average                figure which is the intensity weighted mean hydrodynamic size of the ensemble collection of                 particles measured by dynamic light scattering. Z-averages of size distribution were compared                and plotted.                   3. RESULTS  AND  DISCUSSION                Titration experiments were performed using hyaluronan or surfactant as titrant. In the case of                 surfactant  as titrant,  surfactant concentration linearly increased  during the experiments  and                 zeta potential increased mostly linearly during the titration, too. Initial zeta potential values of                hyaluronan were about −30 mV. These values generally indicate high stability of the colloid                 system.                Size distribution of particles in the systems indicate that hyaluronan oneself without surfactant                 creates  a  wide-ranging  domains  in  the  solution.  A  small  addition  of  the  surfactant  to                hyaluronan solution decreases size distribution of particles in the system. With the increasing                 zeta potential of the system, close to isoelectric point, particles size distribution increases due                 to precipitation of the complex occurs owing to charge neutralization. The colloidal system                exhibits  in  this  point  zero zeta  potential  and  minimum  stability.  When  surfactant                 concentration in the system dominates, size distribution stabilizes about 200-500 nm.                In the case of hyaluronan as titrant, situation of size distribution is analogous to previously                 case. Size distribution of stabilized nanoparticles when hyaluronan is in the system dominate,                is about 200 nm. This may be more suitable method to formation drug delivery nanoparticles,                 which sizes should be in the range of 6 and 200 nm [5].                 In case that surfactant was used as titrant isoelectric point or more precisely point of zero                charge  shows  concentration  of  surfactant  when  positive  charge  of  surfactant  equals  to                                                             75","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  negative charge carrying on hyaluronan chain. It was found that measured isoelectric point                 does  not  correspond  to  theoretical  isoelectric  point  supposing  100%  dissociation  of                carboxylate groups of hyaluronan chain. Isoelectric point occurred at much lower surfactant                 concentration.  It  means  that  less  than  100 %  of  hyaluronan  carboxylate  groups  dissociate,                practically about 50 %.                 When hyaluronan was used as  titrant,  zeta potential  decreases  linearly  during the titration.                Point of zero charge was found at lower hyaluronan concentration than theoretical value if                 100%  dissociation  is  assumed.  It  was  found  that  only  20 %  carboxylate  group  was                 dissociated. Increase of size distribution of aggregates before isoelectric point was observed,                too.                 Concentration of hyaluronan and conformation of hyaluronan in the system have a significant                effect on established degree of dissociation.                                     Figure 1.: Left – Zeta potential and z-average in depending of surfactant concentration (M w                HyA  =  116 kDa),  Right  -    Zeta  potential  and  z-average  in  depending  of  hyaluronan                 concentration (M w HyA = 116 kDa).                  4. CONCLUSION                 Titration experiments were performed to investigation of interaction between hyaluronan and                opposite charged surfactant and to study differences between two methods of preparation of                 this  system.  Increase  of  aggregates  size  was  observed  near  point  of  zero  charge.  The                 hyaluronan-surfactant system exhibits in this point zero zeta potential and minimum stability                result  in  phase  separation.  It  was  found  that  in  the  case  of  hyaluronan  as  titrant,  final                 aggregates are smaller and more stable than when we used surfactant as titrant and therefore                are more suitable for drug delivery applications.                                                                76","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    5. ACKNOWLEDGEMENT                 The work has been supported by Materials Research Centre at FCH BUT- Sustainability and                Development,  REG  LO1211,  with  financial  support  from  National  Programme  for                 Sustainability  I  (Ministry  of  Education,  Youth  and  Sports)  and  COST  action  CM1101,                project No. LD12068.                  6. REFERENCES                 [1]    Girish, K.S. a K. Kemparaju. The magic glue hyaluronan and its eraser hyaluronidase: A biological                       overview. Life Sciences. 2007, vol. 80, issue 21, s. 1921-1943. DOI: 10.1016/j.lfs.2007.02.037.                [2]    Balazs, Endre A. Therapeutic use of hyaluronan. Structural Chemistry. 2009, vol. 20, issue 2, s. 341-                        349. DOI: 10.1007/s11224-009-9435-y.                [3]    WESLEY, Robin D., Terence COSGROVE, Laurie THOMPSON, Steven P. ARMES a Fiona L.                       BAINES.  Structure  of  Polymer/Surfactant  Complexes  Formed  by  Poly(2-(dimethylamino)ethyl                       methacrylate) and Sodium Dodecyl Sulfate. Langmuir. 2002, vol. 18, issue 15, s. 5704-5707.                [4]    RAO, J. Prasad a Kurt E. GECKELER. Polymer nanoparticles: Preparation techniques and size-control                       parameters. Progress in Polymer Science. 2011, vol. 36, issue 7, s. 887-913.                       DOI: 10.1016/j.progpolymsci.2011.01.001.                [5]    GAUCHER, Geneviève, Marie-Hélène DUFRESNE, Vinayak P. SANT, Ning KANG, Dusica                        MAYSINGER a Jean-Christophe LEROUX. Block copolymer micelles: preparation, characterization                        and application in drug delivery. Journal of Controlled Release. 2005, roč. 109, č. 1–3, s. 169–188.                       DOI: 10.1016/j.jconrel.2005.09.034.                                                                                     77","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                    APPLICATION OF CdTe-QUANTUM DOTS NANOPARTICLES FOR                            LUMINISCENCE DETERMINATION OF METAL IONS                                         1                                                                                1,2                                                                1                    Lenka ŘEZÁČOVÁ , Romana ŠEVČÍKOVÁ , Jakub VANĚK , Přemysl LUBAL                 1,2*             1              Department of Chemistry, Faculty of Science, Masaryk University, Kotlářská 2, 611 37 Brno,                Czech Republic             2 Central European Institute of Technology, Masaryk University, Kamenice 5, 625 00 Brno, Czech                Republic                   *lubal@sci.muni.cz                  Abstract                The contribution deals with synthesis and characterization of CdTe-QD nanoparticles covered                 by  mercaptopropionic  acid  (MPA).  The  luminescence  of  particles  (diameter  3-5  nm,  zeta-                                                                                     2+                                                                                           2+                potential -40 mV, pH   6.5) is quenched in presence of metal ions (Cu , Pb ) which can be                utilized for their fast, simple and sensitive determination (LOD   0.5  M).                   1. INTRODUCTION                 Quantum  Dots  (QD´s)  semiconductor  particles  of  1-10  nm  diameter  are  mostly  sparingly                soluble cadmium compounds CdX (X = S, Se, Te). Covering mercaptopropionic acid (MPA),                 glutathione, cystein 2-7  (see Fig. 1) the colloid solubility is increased while the ionization of                their  functional  groups  placed  on  particle  surface  ensures  their  solubility.  Their  unique                 physico-chemical as well as optical luminescence properties can be employed for detection                                                                                                   1-5                and determination of ions, biologically important molecules and many other analytes  since                they do have broad excitation and narrow emission bands which can be tuned by their size,                                                     1-5                morphology and kind of nanoparticles . This contribution presents optimization of synthesis                of  CdTe-QD  nanoparticles,  their  characterization  and  their  potential  application  for                 determination of metal ions by means of luminescence spectroscopy.                                     Figure: Structure of CdTe-QD nanoparticels (adapted according to ref. [6])                                                            78","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                 The  CdTe-QD  nanoparticles  covered  by  MPA  were  synthesized  according  to  literature                          7                procedure  and they were characterized on Zetasizer Nano ZS equipment (Malvern, UK) in                order to determine diameter and zeta potential. Luminescence measurements were carried out                 on spectrofluorimeter AvaSpec 2048 (AVANTES, Netherland) in wavelength region 350-1100                nm using violet laser (wavelength 405 nm, power 200 mW) for excitation.                  3. RESULTS  AND  DISCUSSION                                                           1-7                Several  procedures  found  in  literature   were  utilized  for  synthesis  of  CdTe-QD                nanoparticles.  No  differences  in  physico-chemical  properties  were  observed  for  samples                 prepared in the time course 3-4 hours. The bright-orange colloid solution (pH ~ 6.5) emits                greenish radiation (maximum of emission band about 544 nm) after laser excitation and thus                 the size 3.2 nm was estimated for nanoparticles. In addition, the measurement of nanoparticles                size by means of laser scattering (  = 633 nm) shows that their size is about 5 nm and zeta-                 potential is -40 mV. The decrease of solution pH of prepared of CdTe-QD’s leads to increase                 of zeta-potential and size of nanoparticles (>10 nm) since the carboxylic functional groups                located on surface are gradually protonated. Zeta-potential value is then approaching to zero                 at pH<3 as consequence of fully neutralization of negatively-charged carboxylic groups by                protons leading to agglomeration of nanoparticles to highly organized structures (up to 1500                 nm at pH < 3) and then to precipitation of nanoparticles in form of less soluble compound.                                                                                                           -1                       The self-quenching of CdTe-QD nanoparticles in concentration region 0 – 1.6 µg·ml                                                                            -1                was not observed when diluting stock solution (c   4 µg·ml , pH ~ 6.5). On contrary, this                effect  was  observed  for  higher  concentration  of  CdTe-QD  nanoparticles  therefore  all  other                 experiments have to be done with solution of lower concentration and all other experiments                                                               -1                were carried out at concentration level 1.6 µg·ml  (pH ~ 6.5). Adding CuCl 2 stock solution (c                           -1                = 1 mmol.l ), the shape of luminescence spectra of CdTe-QD’s was not changed, only the                intensity is decreased. This effect can be described as                                                         I 0  I  K   [ M ]                                                            I      SV                 where  I 0  and  I  are  intensities  without  and  in  presence  of  metal  ion,  K SV  is  Stern-Volmer                                                                 5                constant derived for static character of quenching . The following parameters (K SV ~ 3200,                limit of detection 0.64  M) were calculated.                                                                 79","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                             2+                Adding Pb  ions to solution of CdTe-QD nanoparticles, the analogous effect of quenching is                                                                            2+                observed.  Limit  of  detection  is  comparable  as  found  for  Cu   ions,  however  Stern-Volmer                constant K SV is one order of magnitude higher (K SV ~ 21500), thus the determination of larger                                                              2+                Pb(II) ion is more sensitive than for smaller Cu  ion. The results can be slightly improved for                the purified CdTe-QD-nanoparticles.                  4. CONCLUSION                 The CdTe-QD nanoparticles covered by MPA were synthesized and characterized (size, zeta-                                                                          2+                                                                     2+                potential). The presence of some heavy metal ions (Cu , Pb ) led to luminescence quenching                of nanoparticles in solution and this effect was utilized to their sensitive determination which                is  comparable  with  results  obtained  by  other  analytical  methods  (e.g.  ISE  potentiometry,                 differential pulse polarography, molecule absorption spectroscopy, etc.).                  5. ACKNOWLEDGEMENT                 This work was supported by Ministry of Education of the Czech Republic (ME09065), Grant                 Agency  of  Czech  Republic  (grants  13-08336S,  14-12653S)  and  EU  (CEITEC                CZ.1.05/1.1.0/02.0068) program.                  6. REFERENCES                 [1]    Hlaváček A., Skládal P., Chem. Listy, 105 (2011), 611-615.                [2]    Zhang H., Wang D., Yang B., J. Am. Chem. Soc., 128 (2006), 10171-10180.                [3]    Zhang L., Xu Ch., Li B. Microchim Acta, 166 (2009), 61-68.                [4]    Murphy CJ, Anal Chem, 74 (2002), 520A-526A.                [5]    Ali E. M., Zheng Y., Yu H., Y.Ying J., Anal Chem., 79 (2007), 9452-9458.                 [6]    Hezinová V., Ph.D. Thesis, VUT Brno 2011.                [7]    Duan J. L., Song L. X., Zhan J. H., Nano Res., 2 (2009), 61-68.                                                                          80","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                               NANOSECOND LASER FLASH PHOTOLYSIS STUDY                                                  OF ROSE BENGAL                                                            1                                               1                                                                                           1                                                                            1                              Lucie Ludvíková , Peter Šebej , Dominik Heger  and Petr Klán *                 1                   Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, 625 00,                   Brno, Czech Republic and RECETOX, Faculty of Science, Masaryk University, Kamenice                   5, 625 00 Brno, Czech Republic.                    *lucielud@email.cz, klan@sci.muni.cz                  Abstract                   Rose  bengal  (RB)  is  a  well-known  xanthene  dye  used  in  photodynamic  therapy,  textile                                        1                industry  and  cosmetics.   Here  we  report  a  detailed  and  complete  mechanistic  study  of  the                triplet excited state and of oxidized and reduced forms of RB. The kinetics of these reactive                species  were  studied  by  steady–state  spectroscopic  and  kinetic  nanosecond  laser  flash                 photolysis using a 532 nm laser as a source of excitation. Scheme 1 summarizes the processes                                                                                2–                                                                            3                that can be involved upon RB excitation (a): The RB triplet ( RB )disproportionates to give                                 •–                                                      •3–                the  oxidized  (RB )  and  reduced  (RB )  forms  of  RB  (b,  c)  or  undergoes  a  triplet–triplet                annihilation (c). This detailed study is an essential step towards understanding of its role in                                                 2                the photochemical tissue bonding.                               1. h             k                (a)  RB 2            3 RB 2     d    RB 2                              2. ISC                                      k                (b)  3 RB   +  RB 2   gs     RB    +  RB   3  or 2 RB 2                        2                                     k                (c)  3 RB   +   RB 2  T-T    RB    +  RB   3  or 2 RB 2                        2                            3                Scheme 1: Photochemistry of the triplet excited state of RB                       REFERENCES                 1  I. E. Kochevar and R. W. Redmond, Singlet Oxygen, Uv-a, and Ozone, 2000, 319, 20-28.                2  T. S. Johnson, A. C. O'Neill, P. M. Motarjem, C. Amann, T. Nguyen, M. A. Randolph, J. M. Winograd, I. E.                       Kochevar and R. W. Redmond, J. Surg. Res., 2007, 143, 224-229.                                                               81","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                      EPR-UV/VIS/NIR SPECTROELECTROCHEMICAL STUDIES OF                                 SUBSTITUTED DIARYLAMINOTHIOPHENES                                                      *                                    Peter MACHATA , Peter RAPTA, Vladimír LUKEŠ                    Department of Physical Chemistry, Slovak University of Technology, Radlinského 9, SK-                   812 37  Bratislava, Slovak Republic                    *peter.machata@stuba.sk                  Abstract                In  this  contribution,  1,4-bis-(2-diphenylamino-thiophen-5-yl)-benzene  (A)  and  (1,4-bis-[2-                 (phenothiazin-10-yl)-thiophen-5-yl]-benzene (B) consisting of three different groups, namely                 the diphenylamino-, bithiophene- and central phenylene  moiety, respectively, were studied in                detail to get insights to their oxidation mechanism. Different voltammetric techniques, in situ                 EPR-UV/Vis/NIR and NMR spectroelectrochemistry as well as a theoretical study based on                DFT calculations were used to achieve this goal.                   1. INTRODUCTION                In the last decades functionalized oligothiophenes found applications in organic field-effect                 transistors, organic light emitting diodes and solar cells due to their easy structure variation                and large variety of electronic properties [1-4]. The combination of thiophene derivatives with                 diphenylamino-groups made these structures useful as hole-transporting materials for optical                 and  microelectronic  devices  [5].  Based  on  this  finding  different  diarylamino  substituted                oligothiophenes  were  synthesized  and  their  redox  reactions  have  been  studied  by  in  situ                 spectroelectrochemistry [5-7].                In  this  contribution,1,4-bis-(2-diphenylamino-thiophen-5-yl)-benzene  (A)  and  (1,4-bis-[2-                 (phenothiazin-10-yl)-thiophen-5-yl]-benzene (B) consisting of three different groups, namely                the diphenylamino-, bithiophene- and central phenylene  moiety, respectively, were studied in                 detail [8]. The only difference between A and B is that in B the diphenylamino moiety of A is                 replaced by a phenothiazinyl unit.                  2. MATERIAL AND METHODS                 A standard three electrode arrangement of a platinum wire as working electrode, a platinum                wire  as  counter  electrode,  and  silver  wire  pseudoreference  electrode  was  used  in  cyclic                 voltammetric  experiments  with  a  PAR  Potentiostat-Galvanostat  Model  273A  in  glove  box.                                                              82","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Decamethylferrocene (DmFc) was used as internal potential standard. Sample solutions with                 approximate concentration of 0.5 mM, prepared with 0.2 M TBAPF 6 supporting electrolyte in                CH 2Cl 2. Spectroelectrochemical experiments were carried out in flat spectroelectrochemical                 cell (Pt mesh working electrode) in the optical EPR cavity (ER4104OR, Bruker, Germany).                The EPR spectra were recorded on an X-band EMX EPR spectrometer (Bruker, Germany).                 For  in  situ  EPR-UV/Vis/NIR  spectroelectrochemical  studies,  diode-array  Avantes                UV/Vis/NIR spectrometer and potentiostat Heka PG 284 (HEKA Elektronik, Germany) were                 used.  All  spectroelectrochemical  studies  were  performed  in  the  Centre  of                 Spectroelectrochemistry at IFW Dresden (Germany).                  3. RESULTS  AND  DISCUSSION                Cyclic voltammetry of A and B was performed in CH 2Cl 2 containing TBAPF 6 as supporting                 electrolyte.  Both  investigated  compounds  give  cyclic  voltammograms  at  low  oxidation                                            +                                                                                +                potentials (0.69 V vs. DmFc /DmFc for A and 0.81 V vs. DmFc /DmFc for B – Fig. 1). At                cyclic voltammograms, ratio of current between A, repectively B and internal standard DmFc                 at  the first  CV peak was estimated to  2 indicating two electron process. The peak-to-peak                separation corrected for iR drop was estimated to be 60 mV for DmFc, 45 mV for A and 39                                                                                      '                                                                                          '                mV for B. If the second oxidation potential is lower as the first one ( E > E ), and the second                                                                                    1                                                                                         2                oxidation potential doesn't exceeds 180 mV comparing to the first one, the CV peak exhibits                two electron transfer characteristics.                            12                         A     E (A) = 0.69 V                                                           1/2                                                    B     E (B) = 0.81 V                                                           1/2                          8                                               +                                          DmFc /DmFc                        A  4                        I /                          0                           -4                            -0,4            0,0            0,4             0,8                                                       +                                            E  vs. DmFc /DmFc / V                Figure 1.: Cyclic voltammograms of 0.5 mM A (green line) and B (blue line) in CH 2 Cl 2 /TBAPF 6  in the presence                                              –1                of 0.5 mM DmFc (scan rate 50 mV s ).                                                                 83","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Upon electrochemical oxidation of A two optical transitions arise at 662 nm and 1510 nm at                 the potential of the first oxidation peak. Simultaneously broad unresolved EPR spectra with a                relatively low g-factor value of 2.0015 was observed, indicating the presence of a large set of                                 •+                splittings.  For  A ,  spin  density  is  suggested  to  be  delocalized  over  a  large  part  of  the                molecule  (corresponding  with  shape  of  HOMO  orbital.  B  gives  upon  electrochemical                 oxidation similar optical transitions at 700 nm and 1475 nm appear Simultaneously a line-                broadened EPR spectrum with a shifted g-factor value (g = 2.0047) was observed. An EPR                 splitting constant is caused just by one nitrogen atom with a N = 0.65 mT. The high g-factor                 value and the shape of the EPR signal point to the localization of the additional charge and                spin at the phenothiazinyl moiety. This result is in agreement with shape of HOMO orbital.                                                                                                  .+                Applying  Marcus  theory  of  mixed  valence  (MV)  systems  approach  the  cation  A   can  be                                                                                                          .+                assigned  to  delocalized  class  III  Robin-Day  MV  system.  On  the  other  hand  the  cation  B                exhibits characteristics of a localized (class II) MV system.                  4. CONCLUSION                Anodic oxidation of 1 leads to the unstable initially generated radical cation which rapidly                                                                                                .+                dimerizes to the corresponding EPR-silent protonated dimer. The radical cation 4  formed by                electrooxidation  4  is  rather  stable.  For  monomers  2a,  2b  and  3,  the  oxidation  leads                 immediately  to  the  electrodeposition  of  an  polymer  film  on  the  electrode  surface.  The                 electrochemical  stability  of  these  polymers  and  reversible  changes  of  their  UV/Vis/NIR                spectra in the broad wavelength range upon redox cycling indicate their promising application                 as stable electrochromic materials.                  5. ACKNOWLEDGEMENT                The financial support of the Slovak Grant Agency VEGA (contract No. 1/0307/14 and No.                 1/0289/12) and APVV-0202-10 and IFW Dresden is gratefully acknowledged.                 6. REFERENCES                 [1]  Facchetti, A.: Mater. Today 10 (2007) 28-37.                [2]  Li, Z.H., Wong, M.S., Fukutani, H., Tao, Y.: Chem. Mater 17 (2005) 5032-5040.                [3]  Shirota, Y., Kageyama, H.: Chem. Rev. 107 (2007) 953-1010.                [4]  Mishra, A., Ma, C.-Q., Bäuerle, P.: Chem. Rev. 109 (2009) 1141-1278.                [5]  Schumann, J., Kanitz, A., Hartmann, H.: Synthesis 9 (2002) 1268-1277.                [6]  Gerstner, P., Rohde, D., Hartmann, H.: Synthesis 17 (2002) 2487-2489.                 [7]  Tabet, A., Schroder, A., Hartmann et al.: L., Org. Lett. 5 (2003) 1817-1820.                [8]  Rapta, P., Haubner, K., Machata, P. et al.: Electrochim. Acta, 110 (2013) 670–680                                                            84","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                       EPR-UV/VIS/NIR SPECTROELECTROCHEMISTRY OF THIENYL                                             DERIVATIVES OF PYRENE                                                      *                                    Peter MACHATA , Peter RAPTA, Vladimír LUKEŠ                1                   Department of Physical Chemistry, Slovak University of Technology, Radlinského 9, SK-                   812 37  Bratislava, Slovak Republic                    *peter.machata@stuba.sk                  Abstract                A  detailed  spectroelectrochemical  and  theoretical  study  of  thienyl  derivatives  based  on                 pyrene,  namely  1-(2-thienyl)-pyrene  (1),  1,6-bis(2-thienyl)-pyrene  (2a),  1,4-bis(2-thienyl)-                 pyrene (2b), 1,3,6-tris(2-thienyl)-pyrene (3) and 1,3,6,8-tetra(2-thienyl)-pyrene (4), and their                oxidation  products  with  focus  on  the  formation  of  their  corresponding  cationic  states  are                 presented.  Regioregular  polymeric  systems  were  prepared  by  means  of  electrochemical                polymerization  from  monomers  2a,  2b  and  3.  The  redox  behavior  of  the  corresponding                 polymers  was  studied  by  cyclic  voltammetry  and  in  situ  EPR-UV/Vis/NIR                spectroelectrochemistry with the aim of obtaining details on the type of charge carriers within                 the polymer film.                  1. INTRODUCTION                 Fluorescence probes based on pyrene moieties have attracted considerable attention over the                 last  decades  [1,  2].  The  pyrene  moiety  represents  a  unique  fluorescent  probe  and  its                derivatives have found brought applications in sensors [3, 4], liquid crystals [5], organic light-                 emitting  diodes  [6],  as  electrochromic  applications  [7],  transistors  [8],  photoactive                 polypeptides [9] and genetic probes [10]. Pyrene units can serve as components for various                types of fluorescent polymers and dendrimers [11].                 In  this  work,  we  performed  a  detailed  spectroelectrochemical  and  theoretical  study  on  the                electron transfer in new thienyl derivatives of pyrene and their oxidation products with focus                 on the formation of their corresponding cationic states [12].                  2. MATERIAL AND METHODS                 A standard three electrode arrangement of a platinum wire as working electrode, a platinum                 wire  as  counter  electrode,  and  silver  wire  pseudoreference  electrode  was  used  in  cyclic                voltammetric  experiments  with  a  PAR  Potentiostat-Galvanostat  Model  273A  in  glove  box.                                                              85","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Decamethylferrocene (DmFc) was used as internal potential standard. Sample solutions with                 approximate concentration of 0.5 mM, prepared with 0.2 M TBAPF 6 supporting electrolyte in                CH 2Cl 2. Spectroelectrochemical experiments were carried out in flat spectroelectrochemical                 cell (Pt mesh working electrode) in the optical EPR cavity (ER4104OR, Bruker, Germany).                The EPR spectra were recorded on an X-band EMX EPR spectrometer (Bruker, Germany).                 For  in  situ  EPR-UV/Vis/NIR  spectroelectrochemical  studies,  diode-array  Avantes                UV/Vis/NIR spectrometer and potentiostat Heka PG 284 (HEKA Elektronik, Germany) were                 used.  All  spectroelectrochemical  studies  were  performed  in  the  Centre  of                 Spectroelectrochemistry at IFW Dresden (Germany).                  3. RESULTS  AND  DISCUSSION                 Anodic  cyclic  voltammetry  of  investigated  thienyl  derivatives  of  pyrene  1–4  differs                substantially and depends on the number of thienyl rings present on the pyrene molecule. A                 dominant dimerization reaction was proposed for oxidation of 1 (Fig. 1-a). The lifetime of the                                                                      –5                               .+                radical cation 1  was estimated to be approximately 10  s using fast scan voltammetry. After                proton release, a new π-conjugated dimer D1 is formed irreversibly with a lower oxidation                 peak potential as for the monomer confirming an elongation of the  -conjugation in the dimer.                For electrochemical oxidation of 4, a reversible first anodic peak is found using a scan rate of                        –1                0.1 V s . Even the second oxidation step was found ant it exhibits nearly reversible behavior                                                            .+                (Fig.  1-b).  Therefore,  the  radical  cation  4   formed  by  electrooxidation  is  rather  stable.                                                         –1                However, at low scan rates (e.g. 0.005 V s ) a new cathodic peak at lower oxidation potential                is already observed indicating dimerization or oligomerization reactions.                        (a)                                                                       (b)                            S                                         S                 S                                                A                                        A                                                20                                       3                                                                     S                 S                              0.4   0.6   0.8   1.0   1.2   1.4            0.0    0.4     0.8    1.2    1.6                                                                                             +                                                 +                                E vs. DmFc/DmFc  / V                         E vs. DmFc/DmFc  / V                                                  –1                Figure 1.: Cyclic voltammetry at 0.1 V s  in 0.2 M TBAPF 6 /CH 2 Cl 2  solution of (a) 1 and (b) 4 – one oxidation                step (black line) and two oxidation steps (red line).                                                                86","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    For monomers 2a, 2b and 3, the anodic oxidation leads immediately to the electrodeposition                 of an electroactive material on the electrode surface. After the first scan new redox couples                started to appear and the corresponding current increased after each cycle step. After washing                 with free monomer electrolyte, the film was redox cycled in 0.2 M TBAPF 6 in CH 2Cl 2  a well                defined an reversible redox behavior of such a prepared polymer  (2a) n,   (2b) n and (3) n was                 confirmed.  The  simultaneously  measured  narrow  EPR  singlet  is  similar  to  that  of  other                conducting polymers indicating a delocalized spin.                   4. CONCLUSION                Anodic oxidation of 1 leads to the unstable initially generated radical cation which rapidly                                                                                               .+                dimerizes to the corresponding EPR-silent protonated dimer. The radical cation 4  formed by                electrooxidation  4  is  rather  stable.  For  monomers  2a,  2b  and  3,  the  oxidation  leads                 immediately  to  the  electrodeposition  of  an  polymer  film  on  the  electrode  surface.  The                electrochemical  stability  of  these  polymers  and  reversible  changes  of  their  UV/Vis/NIR                 spectra in the broad wavelength range upon redox cycling indicate their promising application                 as stable electrochromic materials.                  5. ACKNOWLEDGEMENT                 The financial support of the Slovak Grant Agency VEGA (contract No. 1/0307/14 and No.                1/0289/12) and APVV-0202-10 and IFW Dresden is gratefully acknowledged.                  6. REFERENCES                  1]  Benniston, A. C., Fortage, J.: Tetrahedron Lett. 49 (2008) 4292-4295.                 2]  Čapek, I.: Adv. Colloid Interface Sci. 97 (2002) 91-149.                 3]  Martínez-Máñez, R., Sancenón, F.:  Chem. Rev. 103 (2003) 4419-4476.                  4]  Yuasa, H., Miyagawa, N., Nakatani, M., et al.: Org. Biomol. Chem. 2 (2004) 3548-3556.                 5]  De Halleux, V. Calbert, J.-P., Brocorens, et al.: Adv. Funct. Mater. 14 (2004) 649-659.                 6]  Daub, J., Engl, R., Kurzawa, J. et al.: J. Phys. Chem. A 105 (2001) 5655-5665.                  7]  Kung, Y. C., Hsiao, S. H., J.: Mater. Chem. 21 (2011) 1746-1754.                 8]  Anant, P., T. Lucas, N., Ball, J. M. et al.: Synth. Met. 160 (2010) 1987-1993.                 9]  Jones II, G., Vullev, V. I.: Org. Lett. 4 (2002) 4001-4004.                  10]  Hwang, G. T., Seo, Y. J., Kim, B. H.: J. Am. Chem. Soc. 126 (2004) 6528-6529.                 11]  Baker, L. A., Crooks, R. M.: Int. J. Biol. Macromol. 33 (2000) 9034-9039.                 12]  Machata, P., Rapta, P., Lukeš, V. et al.: Electrochim. Acta 122 (2014) 57-65.                                                               87","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                       HOW TO MEASURE QUANTITATIVE                                         EPR SPECTRA REPRODUCIBLY                                              Milan MAZÚR*, Marián VALKO                  Department  of  Physical  Chemistry,  Institute  of  Physical  Chemistry  and  Chemical  Physics,                 Faculty  of  Chemical  and  Food  Technology,  Slovak  Technical  University  in  Bratislava,                Radlinského 9, SK-812 37 Bratislava, Slovakia                 *milan.mazur@stuba.sk                 Abstract                 The  objective  of  this  contribution  is  to  provide  useful  suggestions,  recommendations  and                simple  procedures  to  minimise  the  influence  of  primary  error  sources  in  quantitative  EPR                 measurements. When the below presented recommendations and procedures were used in our                quantitative EPR experiments (with a Bruker EPR spectrometer using a Bruker double TE 104                 rectangular cavity and air conditioning) the EPR signal intensity of a wide range of samples                 could be obtained with experimental errors between 3-5%. We believe that these tips can be                helpful in quantitative EPR practice.                   1. INTRODUCTION                A multitude of error sources influence the data accuracy of quantitative EPR spectroscopy.                 The serious problems associated with reproducibility in quantitative EPR measurements were                clearly demonstrated in the comparison of the results obtained from international experiments                 in 1962 (coordinated by prof. Kohnlein [1]) and 1992-92 (coordinated by prof. Yordanov [2]).                In principle, experimental errors in quantitative EPR measurements for a given laboratory and                 a given EPR spectrometer, may be reduced in carefully performed experiments to 2-5% [1, 2].                 However,  in  practice,  quantitative  analysis  of  the  same  sample  in  different  laboratories                produced  results,  which  in  the  worst  cases  were  incompatible  and  in  others  gave  an                 uncertainty between ca 100-200% [1, 2]. No satisfactory explanation for this discrepancy has                been  found  at  present.  The  main  objective  of  this  contribution  is  to  provide  useful                 suggestions,  recommendations  and  simple  procedures  to  minimise  the  influence  of  the                selected primary error sources in quantitative EPR measurements.                                                                  88","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                 The pairs of the cylindrical samples of various internal diameter (i.d.) and length (L) were                prepared.  Quantitative  EPR  spectra  were  recorded  and  evaluated  according  to  the  same                 procedures as described in our previous papers. For further details see elsewhere [3, 4].                  3. RESULTS  AND  DISCUSSION                As a representative example, the comparison of cylindrical samples with identical volumes                 but different shapes is illustrated. The experimental arrangement is outlined in the Figure 1.                                  Figure 1.: Schematic diagram of the cross section of the microwave rectangular cavity, in the                centre of which cylindrical samples with identical volume, but different shape (a) and (b) are                inserted.                 The  material,  volume  and  mass  of  the  pairs  of  the  compared  samples  was  identical.  The                 experimentally observed difference in the EPR signal intensity, Ipp(1)−Ipp(2), between the                given samples with shape (a) and (b) are summarised in the Table 1.                  Table 1.: Pairs of cylindrical samples with identical sample volume (V) but with different                sample shape indicated by corresponding sample internal diameter (i.d.) and length (L). The                experimentally obtained Ipp(1)−Ipp(2)} difference is given as a percentage of the smaller Ipp                value.                                   3                           V [mm ]    i. d. [mm]   L [mm]   Ipp(1)/Ipp(2) [a.u.]   Ipp(1) - Ipp(2) [%]                             62.83        4          5                                                                   2.98               198 %                             62.83        2         20                            125,66        4         10                                                                   3.78               278 %                            125.66        2         40                             15,71        2          5                                                                   4.13               313 %                             15.71        1         20                             31,42        2         10                                                                   5.32               432 %                             31.42        1         40                                                              89","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  It is clear from Table 1 that the comparison of the pairs of the samples with identical volumes                 but  different  sample  shapes  show  signal  intensity  differencies  between  ca  200-400  %.                However, when the sample shapes were identical the differencies were found between 3-5%.                 It is obvious that the different sample shape (in the spite of identical sample volume, material                and also sample mass) could be responsible for the essential difficulties in the quantitative                 EPR measurements. For more information see Ref. [3].                  4. CONCLUSION                 For the samples which are to be compared in quantitative EPR measurements, the following                recommendations  were  selected:  a)  The  shape  of  all  samples  should  be  identical.  b)  The                 position of the sample/reference in the cavity should  be identical. c) The wall thickness of                sample tubes should be identical. d) The shape and wall thickness of quartz Dewars (if used)                 should be identical. d) A double TE 104 rectangular cavity should be used in quantitative EPR                spectroscopy.  e)  The  dielectric  properties  of  unknown  and  standard  samples  should  be  as                 close as possible. f) The use of commercially distributed software for postrecording spectra                 evaluation  is  a  basic  necessity.  g)  The  sample  and  laboratory  temperature  should  be  kept                constant  during  all  measurements.  See  Ref.  [5]  for  further  detailed  information.  When  the                 above  mentioned  recommendations  and  procedures  were  used  in  our  quantitative  EPR                 experiments (with a field modulated CW Bruker EPR spectrometer using an original Bruker                double TE 104 rectangular microwave cavity and air conditioning) the EPR signal intensity of                 a wide range of samples could be obtained with experimental error between 3-5%.                  5. ACKNOWLEDGEMENT                This  work  was  supported  by  the  Slovak  Research  and  Development  Agency  under  the                 contract  Nos.  (APVV-0202-10  and  APVV-0339-10)  and  Scientific  Grant  Agency  of  the                 Slovak Republic (Projects VEGA 1/0765/14 and VEGA 1/0289/12).                  6. REFERENCES                [1]  Kohnlein W.: In Ebert M., Howard A. (Eds.), Radiation Effects in Physics, Chemistry and Biology,                     Nord-Holland, Amsterdam, 1963, p.206.                [2]  Yordanov N.D., Ivanova M.: Appl. Magn. Reson. 6 (1994) 333.                [3]  Mazur M., Morris H., Valko M.: J. Magn. Reson. 129 (1997) 188–200.                [4]  Mazur M., Valko M., Morris H.: Appl. Magn. Reson. 20 (2001) 317–344.                [5]  Mazur M.: Anal. Chim. Acta 561 (2006) 1–15.                                                              90","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                           UTILIZATION OF FLUORESCENCE SPECTROSCOPY FOR                       STUDYING OF THE INTERACTIONS IN DRIED SYSTEMS OF                                BIOPOLYMER AND HYDROPHOBIC SPECIES                                                        *                                Petra MICHALICOVÁ , Miloslav PEKAŘ, Filip MRAVEC                  Centre  for  Material  Research,  Faculty  of  Chemistry,  Brno  University  of  Technology,                 Purkynova 118, 612 00 Brno, Czech Republic                *xcmichalicovap@fch.vutbr.cz                   Abstract                Molecules  of  biopolymers  such  as  hyaluronan  or  carboxymethylcellulose  have  hydrophilic                 character. On the other side the chains of these natural compounds contain also hydrophobic                areas. These parts are often protected by water molecules that are probably highly organized.                 The  interactions  between  native  hydrophilic  biopolymers  and  hydrophobic  solutes  were                studied using the method of fluorescence spectroscopy. It was observed, that drying of the                 systems open up the binding sites for hydrophobic compounds. After system rehydration the                 hydrophobic  solutes  are  locked  up  the  hydrophobic  solutes  are  locked  up  on  the  chain  of                biopolymer by the molecules of water.                  1. INTRODUCTION                 Hyaluronan is a biopolymer, which can be qualified as essential for vertebrates. It is a major                component  of  most  of  tissues.  Besides  of  the  mechanical  functions  this  compound  is                 important for many biological processes 0, 00. The molecule of hyaluronan has hydrophilic                 character.  The  chain  of  biopolymer  contains  also  the  hydrophobic  parts,  but  they  are  not                accessible and the hydrophilic character of molecule prevails. 0. On the other side, many of                 drugs  or  vitamins  are  hydrophobic  0.  The  aim  of  this  work  was  the  study  of  systems                 biopolymer-fluorescence  probe.  The  drug  in  our  studied  system  is  substituted  by  the                hydrophobic  fluorescence  probe  which  allows  the  monitoring  of  the  interaction  between                 components  using  fluorescence  spectroscopy.  Besides  the  hyaluronan  another  model                biopolymers were used too.                                                                      91","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                              Figure 1.: Hydrophilic (blue) and hydrophobic (red) parts on the chain of hyaluronan 0                  2. MATERIAL AND METHODS                In the first part of the work the samples for drying were prepared. Three different molecule                 masses of hyaluronan (CPN spol. s r.o.) were used (100 kDa; 420 kDa; 1,46 MDa) and the                                                            −3                concentration of the biopolymer was 1 g·dm . As the fluorescence probe, perylene (Sigma                Aldrich) was chosen for his significant hydrophobic character. Concentration of perylene was                              −3                    −6                5·10  mol·dm . All components were prepared in water solution and dried by low pressure.                After complete drying the samples, the product was rehydrated by water.                 These  samples  were  measured  on  spectrofluorimeter  Fluorolog  Horiba  Jobin  Yvon  at  the                temperature 25 ºC. For comparison the blank samples were prepared from the biopolymer and                 fluorescence probe in the water without drying step.                The same approach was used with other biopolymers such as carboxymethylcellulose (Sigma                 Aldrich) or sodium alginate (Sigma Aldrich), but in this paper we selected just the results with                 hyaluronan.                  3. RESULTS AND DISCUSSION                 The molecule of perylene, which was for purposes of this work used as replacement for drug                molecule, has high hydrophobic character. By this reason perylene is non-soluble in water and                 therefore  it  does  not  provide  fluorescence  signal.  After  dissolving  in  more  hydrophobic                environment, the fluorescence response is more significant. This fact is basic for discussion of                 supporting of interactions by drying of our systems 0.                Figure  2  shows,  that  undried  sample  with  100 kDa  hyaluronan  and  perylene  dissolved  in                 water  has  almost  zero  intensity  of  fluorescence  (orange  line).  This  tells  us  that  without                 supporting of the interactions with drying the perylene dissolved in water does not interact                with hyaluronan chain. The hydrophobic parts on the chain of biopolymer were not accessible                 for  molecules  of  hydrophobe.  Organized  water  creates  the  barrier  and  molecules  of                fluorescence  probe  stay  undissolved  in  the  water.  After  drying  of  the  system  enough,  the                 desired  areas  on  the  chain  are  locked  up  and  the  molecules  of  perylene  can  interact  with                                                             92","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    biopolymer. Perylene surrounded by hydrophobic environment of the chain provided strong                 fluorescence  signal.  The  intensity  of  the  fluorescence  is  related  to  the  polarity  index  of                sample. The green line in the Figure 2 shows significant increase of the fluorescence signal,                 so  we  can  suppose  that  the  components  interact.  Similar  results  we  observed  from  all                measurements, even with different biopolymers (CMC, sodium alginate).                                       Figure 2.: Emission scan of dried and undried system containing hyaluronan with molecular                                                                                                      −3                                                                                             −6                                                       −3                mass 100 kDa and concentration 1 g·dm  and perylene with concentration 5·10  mol·dm                On Figure 3 is displayed the influence of drying on supporting of the interactions in studied                systems for three different molecular mass of hyaluronan. With increasing molecular mass of                biopolymer the fluorescence signal decreases. This trend is contrary to the expected results.                 Longer chain of biopolymer should provide more binding places for hydrophobic probe. This                 can  be  caused  by  conditions  or  duration  of  drying.  Other  experiments  with  different                concentration or biopolymer do not show such a trend. The most important fact is that the                 interactions between the components of system were confirmed for all measurements.                                       Figure  3.:  Influence  of  drying  on    increasing  of  fluorescence  signal  of  three  different                molecular mass of hyaluronan in the system with perylene                                                             93","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  4. CONCLUSION                 The  method  of  fluorescence  spectroscopy  was  used  as  main  measuring  method  for                investigation  of  the  interactions  between  hydrophilic  native  biopolymers  and  hydrophobic                 fluorescence probe. As studied biopolymers hyaluronan, carboxymethylcellulose and sodium                alginate were chosen. Perylene was used as the fluorescence probe. The results show that the                 perylene has no fluorescence response if we just mixed up the components in water solution.                On  the  other  side  dried  and  rehydrated  system  provided  significant  fluorescence  signal.                 Therefore we consider the drying of the studied system as a useful tool for supporting of the                 interactions between biopolymers and hydrophobic species.                  5. ACKNOWLEDGEMENT                Materials  Research  Centre  at  FCH  BUT-  Sustainability  and  Development,    REG  LO1211,                 with financial support from National Programme for Sustainability I (Ministry of Education,                Youth and Sports).                   6. REFERENCES                [1]Vandamme E, De Baets S, Steinbüchel A.: Biopolymers – Polysaccharides 1. Wiley, (2002), 379–406                [2]Scott J: Glycoforum [online], (1998)                 [3]Hascall V, Laurent T: Glycoforum [online], (1997)                [4]Brown T: Current pharmaceutical biotechnology, 4 (2008), 253–260                [5]Valeur, B.: Molecular Fluorescence: Principles and Applications. Wiley, (2001), 34–70                                                                                   94","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                          DETERMINATION OF ORGANIC ACIDS IN WINE USING BY                                                      BIOSENSORS                                                          1                                                                         2                               Miodrag  MILOVANOVIC , Jiri ZERAVIK , Petr SKLADAL         1,2                     1                                                       2                     Department  of  Biochemistry,  Faculty  of  Science,  and  CEITEC  –  Central  European                    Institute of Technology Masaryk University, Kamenice 5, 625 00 Brno, Czech Republic                e-mail: mikimilovanovic@gmail.com                  Abstract                 The  flow-through  one-channel  amperometric  biosensor  is  presented  for  determination  of                 organic (carboxylic) acids. It is based on two sensor layers that are deposited on a platinum                elctrode. The inner layer eliminates interferences by limiting diffusion of electrochemically                 active  substances  such  as  ascorbic  acid,  polyphenol  compounds.  This  layer  is  electro-                polymerized  using  the  equimolar mixture of  o-phenylenediamine and  resorcinol. The outer                 layer is prepared by cross-linking the enzyme sarcosine oxidase and bovine serum albumin                using  glutaraldehyde.  The  formation  of  enzymatically  produced  hydrogen  peroxide  is                 monitored at 650 mV vs. an Ag/AgCl reference electrode. The addition of carboxylic acids                 causes  competitive  inhibition  of  the  enzyme  and  a  decrease  in  signal.  The  assay  was                optimized for determination of carboxylic acids in wine samples. Following 10-fold dilution,                 most samples contain 1–10 mM individual carboxylic acids and thus a 5 mM concentration of                 sarcosine was chosen as being optimal for competition. In case of real samples, the biosensor                measured the sum of all carboxylic acids, which serves as a parameter describing the quality                 of wines. Results from testing of 31 wines are reported.                  1. INTRODUCTION                Organic acids are one of the most important components which are especially responsible for                 its acidity and tartness. The content of carboxylic acids in wine is dependent on the region of                 grapes  growing  and  the  associated  climatic  conditions.  Wines  originating  in  the  northern                regions typically contain a greater proportion of acids, particularly malic acid, while the wines                 from the Mediterranean area exhibit lower acidity. The predominant representants found in                wines are tartaric, malic, citric, succinic, lactic and acetic acids. Tartaric, malic and citric acid                 originate  in  grapes  while  succinic  and  acetic  acid  are  produced  during  the  fermentation                process. The wines from northern regions typically contain higher amounts of malic acid; the                                                               95","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  level  of  malic  acid  is  decreased  by  the  malolactic  fermentation,  resulting  in  reduction  of                 acidity and tartness [1].                This fermentation is rather difficult to control, hence monitoring of ratio of malic and lactic                 acids in treated wine is require. In our case, sarcosine oxidase (SOD) was used for monitoring                of this process using an electrochemical biosensor. The decrease of malic acid was monitored                 through decreasing inhibition of SOD.                The widely employed analytical methods for the determination of organic acids in wine are                 based on determination of the total quantity of acids in wine. Capillary electrophoresis with                 direct and undirect detection (CE) was performed [2]. As another alternative, various types of                biosensors for determination of individual organic acids were introduced. Biosensor for the                 determination of malate employs enzyme malate dehydrogenase (MDH) [3]. Another way to                monitor  the  acids  content  is  the  use  of  enzyme  inhibition  by  organic  acids.  Developed                 biosensor  was  based  on  competitive  reversibile  inhibition  of  sarcosine  oxidase  (SOD)  by                organic acids in the presence of sarcosine. SOD was inhibited by malate, citrate, succinate,                 acetate, formate and partially tartrate while lactate provided very small inhibition effect. The                 goal of this work was comparison of the SOD biosensors with capillary electrophoresis (CE)                as  standard  method.  In  this  case,  31  wine  samples  from  companies  Znovín  (Znojmo)  and                 winery Jaroslav Tichý (Rybníky,) were analysed.                  2. MATERIAL AND METHODS                 Sarcosine oxidase (SOD, EC 1.5.3.1, from Bacillus sp., 25–50 units·mg-1), sarcosine, bovine                serum albumin, o-phenylenediamine, resorcinol, glutaraldehyde (GA), L-lactic acid, L-malic                 acid,  succinic  acid,  phthalic  acid  and  cetyltrimethylammonium  bromide  (CTAS)  were                purchased  from  Sigma.  Acetic  acid,  citric  acid,  formic  acid,  tartaric  acid,  glycine,  sodium                 hydrogenphosphate,  sodium  dihydrogenphosphate,  potassium  chloride,  hydrogen  peroxide                 and L-ascorbate were purchased from Penta.                Polymerization proces                 The working electrode was coated with a thin layer of the selective noncondutive copolymer                (2mM o-phenylenediamine and 2mM resorcinol) which grows until its maximum thickness.                 As the surface becomes isolated, electric current decreases in relation with increasing polymer                thickness.                 Biosensors                                                                                -2                Enzyme  layer  was  prepared  by  cross-linking  of  SOD  (5  U.cm )  with  2%  GA  in  50  mM                                                                                   -1                phosphate (pH 7.4). The mixture was supplemented with 100 mg.ml  BSA in order to reach                                                            96","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                          -2                the density of 2 mg.cm . The immobilization mixture was deposited on the copolymer-coated                working electrode and stored at 4°C.                Capillary electrophoresis                 An Agilent  7100  CE  System  (Waldbronn,  Germany)  equipped  with  a  diode-array  UV–Vis                detector was used to perform all analyses.                  3. RESULTS  AND  DISCUSSION                 Copolymer permeability                 Permeability was monitored with  10 mM  hydrogen peroxide (analyte) and 1  mM  ascorbic                acids  (interfering  compound)  before  and  after  deposition  of  the  copolymer;  measurements                 were performed on gold working electrode at +650 mV vs. Ag/AgCl in 100 mM KCl and 10                mM potassium phosphate pH 7.4.                   Table 1: Permeability of copolymer   Spontaneus   *The   percentage   values   were                                                    deposition   calculated  using  following  formula:                                                                 %  (after) = i  after/ i befor x 100                               Before [%]           After [%]*                H 2 O 2                100              117                Ascorbate              100             0.001                   Principle of competitive reversible inhibition                             sample + substrate buffer                                                              70                                                              60                                                             SO biosensor [mM]  30                                      substrate               50                  i / nA                                      40                                                                   20                                substrate                                                              10                                                               10    20    30    40    50    60    70    80                                  time / sec                                     CE [mM]                Figure  1:     Amperometric  signal  during                competitive  reversible  inhibition  of  immobilized   Figure  2:    Comparison  of  SOD  biosensor  responses  vs.  CE                sarcosine oxidase                          analysis                                                                  97","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Table 2: The effect of carboxylic  Inibitor          Slope          of  Linear                                                                                                    -1                                                                                     -6                acids    on   the    activity   of                   inhibition  x  10   range[mol.L ]                                                                            -1                immobilized  sarcosine  oxidase  in                  [L.mol ]                the presence of 5 mM sarcosine      Citric acid      98.9                0.5-5                                                    Succinic acid    59.7                0.5-8                                                    Malic acid       56.6                0.5-8                                                    Acetic acid      35.5                0.5-10                                                    Formic acid      32.2                0.5-10                                                    Lactic acid      2.8                 -                 4. CONCLUSION                Analysis of wine samples using biosensors and CE showed correlation between the results                 obtained  by  both  methods.  From  that  is  evident  the  biosensors  can  not  fully  replace  the                standardized method, but on the other hand, its mobility and simplicity of determination allow                 their use in the field during on-line monitoring of fermentation processes in comparison to                 CE. In this case, their function is not to determine the absolute values of the analytes, but                continuous monitoring of increase or decrease of the signal in the time frame which can be a                 major shift in the production of quality wines.                  5. ACKNOWLEDGEMENT                 This work was supported by the Ministry of Education, Youth and Sports of Czech Republic,                programme NPV II (2B08035).                  6. REFERENCES                 [1] Casey JA (1990) Oenology: Acidity, pH and sourness in wine.The Aust Grapegrower and Winemaker 313:15                [2] Compendium of International Methods of Wine and Must Analysis, Volume 1, OIV, Paris, Edition 2013.                [3]R. Monosik, M. Strednansky, G. Greif, E. Sturdik, Cent. Eur. J. Chem., 10 (2012) 157.                                                                            98","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                        NEW KINETIC MODELS IN BIOPOLYMER DEGRADATION: LONG TERM                                          STUDY OF HYALURONAN SAMPLES                                     Jakub Mondek*, Vasile Simulescu, Miloslav Pekař                 Materials Research Centre, Faculty of Chemistry, Brno University of Technology, Purkyňova                118, 612 00 Brno, Czech Republic                 *xcmondek@fch.vutbr.cz                  Abstract                 Degradation  of  hyaluronan  samples  was  studied  by  size  exclusion  chromatography  -  multi                angle laser light scattering (SEC-MALLS). The degradation was observed in powder as well                 as in solution. Rate of degradation increased at room temperature as expected according to                Arrhenius law. It was not possible to use first order kinetics for description of the degradation.                 We used zero order kinetic model and empiric model, but similar to first order kinetics.                  1. INTRODUCTION                 Hyaluronan is a linear natural polysaccharide of the glycosaminoglycans family. Its chemical                structure  comprises  disaccharide  units  composed  of  D-glucuronic  acid  and  N-acetyl-D-                 glucosamine, which are alternatively linked through 1,3 and 1,4 glycosidic bonds 0.                 All the authors deal with degradation dependent on pH 0,0, temperature 0,0 or they deal with                addition  of  other  compound  (hydrogen  peroxide  0  for  instance).  But  no  one  deals  with                 stability of hyaluronan powder or hyaluronan solutions after hyaluronan powder is dissolved                in water. What is the time stability of hyaluronan after mixing the solution? We report about                 the time stability of hyaluronan solution and kinetics of time degradation.                  2. MATERIALS AND METHODS                 In  our  work  we  studied  the  hyaluronan  degradation  in  aqueous  solutions  of  two  different                molecular  weight  hyaluronic  acid  samples  by  using  SEC-MALLS,  in  order  to  observe  the                 modification of molar mass, polydispersity and polymer conformation in time.                SEC-MALLS technique allows:                 the separation of different polymeric compounds function of molecular weight                                                                                             9                                                                                   2                the determination of absolute molar mass averages (eqs. 1-3) from 10  Da to 10  Da                           n  M                      n  M  2                   n  M  3                 M          i   i    (1)  ;     M     i  i    (2)  ;     M      i  i                   n                             n i            w        n i M  i          z       n i M i 2    (3)                                                              99","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  M - number average molar mass; M  - weight average molar mass; M  - z average molar                  n                                  w                                  z                mass; n  - number of molecules with molar mass M i.                       i                The  mobile  phase  used  was  0.1  M  NaNO 3  aqueous  solution,  containing  3  mM  NaN 3  to                 prevent microorganism growing. For the same reason an UV lamp was also used.                All hyaluronic acid samples used in this study were obtained from Contipro (Czech Republic)                 where  are  produced  by  fermentation  (Streptococcus  equi.,  subsp.  Zooepidemicus  bacterial                 strain). The analyzed samples were of different molar masses, as follows (HA - hyaluronic                acid or hyaluronan):                 HA 1MDa: Mw = 1 MDa                HA 0.75MDa: Mw = 752 kDa                  3. RESULTS  AND  DISCUSSION                 According to  Tokita  and Okamoto  0, degradation of hyaluronan obeys first  order kinetics.                 Dependencies of molecular weights on time, determined in samples kept at room temperature,                suggest  exponential  decay.  By  linearizing  first  order  kinetic  equation  we  found  out  that                 dependencies are not linear.                Explanation is found in comparison of linear dependencies of the same hyaluronan samples                 kept in the fridge and non-linear dependencies of samples kept at room temperature and in                behaviour of low molecular weight hyaluronan. Degradation of hyaluronan kept in the fridge                 should  be  slower  than  in  samples  at  room  temperature  according  to  Arrhenius  law.  The                 experimental data depicted in Figure 1 support this prediction.                Also the probability of degradation of low molar mass hyaluronan is lower, because there are                 less glycosidic bonds to break. We suggest two degradation models for the rate of hyaluronan                 degradation.  First  is  zero  order  kinetics.  We  suggest  that  degradation  rate  changes  when                certain level of degradation is reached (12.5 % for HA 1 MDa, 6.8 % for HA 0.75MDa). This                 means that every dependence looks as exponential decay, but mathematically is not possible                to fit dependencies with first order kinetic exponential function and linearizing of the equation                 (ln M  w   kt  ln M ),  and  the  data,  gives  us  non-linear  dependence  as  in  case  of  non-                                    0                linearized  data.  In  fact,  there  are  two  separate  kinetic  units  in  each  sample  kept  at  room                 temperature. Samples kept in the fridge probably have linear dependence because they did not                reach  the  second  degradation  level  to  date.  Thus,  kinetic  model  suggested  by  Tokita  and                 Okamoto is not useful in our study. We suggest that time degradation of hyaluronan obeys                zero order kinetics according to approximated equation for zero order kinetics:                                                              100","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                         M  w  M  0  kt , (4)                 where M w represents molecular weight of degraded hyaluronan, M 0 initial molecular weight of                 hyaluronan, k the rate constant of degradation and t is time. Time derivative of Equation 4                gives us rate constant as a slope of linear dependence:                                                        dM  w   k . (5)                                                         dt                 By fitting Equation 4 in molar mass decrease from Figure 1, the final values found for the                degradation  rates  in  solution  at  room  temperature  after  30  days  are  obtained:                                      1                                                                                    1                  . 9 43  10  2   kDa  hour   for  HA  1MDa  and  6 . 84  10  2   kDa  hour   in  the  case  of  HA                                                                                                      1                0.75 MDa, respectively. After 30 days, rate constants decreased to  56.2  10  3   kDa  hour  and                                     1                 . 1 02  10  2   kDa  hour   for  HA  1 MDa  and  HA  0.75 MDa  hyaluronan,  respectively.  The                dependences of M w on time of samples kept in the fridge are strictly linear for both 1 MDa                 and  0.75 MDa  hyaluronan  solutions.  Again  from  the  fit  of M  w  f  t   we  obtained  rate                                                                                            1                                                                1                constants of degradation of  05.1  10  2   kDa  hour  and  11.1  10  2   kDa  hour  for HA 1 MDa                and HA 0.75 MDa hyaluronan, respectively. We cannot  compare individual  values of rate                 constants of different molecular weights, because we have different range of y axis. But when                we  compare  rate  constants  of  each  hyaluronan  sample,  we  can  see  slower  degradation  in                 second decrease region as mentioned above. It is actually expected, because hyaluronan has                 lower  molecular  weight  and  probability  of  degradation  of  lower  molecular  weight  should                decrease, which is shown by fitting Equation 4 in experimental data. Kinetic calculations also                 confirm behaviour of degradation at different temperature in according to Arrhenius law.                The second degradation model for samples at room temperature was derived empirically:                                                  Mw     M     M diff  e  kt , (6)                 where M diff represents difference between molecular weight of fresh hyaluronan sample and                 last  determined  value  of  measured  molecular  weight.  M   represents  asymptotic  value                 att        e     0. At these conditions, Equation 6 changes to:                                                        M w   M . (7)                 Fit of  M  w  f  t  with Equation 6 yields overall rate constants for all hyaluronan samples.                 Comparison of adjusted R-square determined by Origin shows, that statistically is better to                 use exponential dependence derived empirically but in first phase of degradation, zero order                kinetics fits as well. But in case of hyaluronan samples kept in the fridge it was not possible to                                                                101","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  fit the data with Equation 6 so in that case we used only zero order kinetics to extract rate                 constants of degradation.                                     Figure 1:  The  degradation  of  HA  0.75  MDa  (a)  and  HA  1MDa  (b)  in  time  at  room                 temperature and in the fridge                  4. CONCLUSION                 We suggest two kinetic models for hyaluronan degradation. Zero order kinetic model fits the                data for samples at room temperature and for samples kept in the fridge. Equation 6 fits well                 data for samples kept at room temperature. Therefore we show that degradation of hyaluronan                at room temperature is possible to describe by two models as described above. For samples                 kept in the fridge we cannot use Equation 6 to fit the data, because these dependencies are                 linear.                  5. ACKNOWLEDGEMENT                The  authors  acknowledge  the  financial  support  of  project  Excellent  Teams  -                 CZ.1.07/2.3.00/30.0005 and the project LO 1211 Ministry of Education, Youth and Sports of                Czech Republic                   6. REFERENCES                [1]Lapcík L; De Smedt S; Demeester J; et all., Chemical Reviews, 8 (1998), 2663-2684                [2]Tokita Y; Okamoto A, Polymer Degradation and Stability, 2 (1995), 269-273                [3]Bothner H; Waaler T; Wik O, International Journal of Biological Macromolecules, 5 (1988), 287-291                 [4]Reháková M;Bakoš D; Soldán M;et all., International Journal of Biological Macromolecules,  (1994),121-124                [5]Šoltés L; Brezová V; Stankovská M; et all., Carbohydrate Research, 5 (2006), 639-644                                                                102","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                               OXIDATION OF AND DNA ADDUCT FORMATION BY                        BENZO[A]PYRENE BY RAT CYTOCHROME P450 1A1 ARE                               STIMULATED BY CYTOCHROME B  AND NADH                                                                             5                                                              1                                     1*                                                                               1                                                                                              1                                                                                                         2                 Marie STIBOROVÁ , Michaela MOSEROVÁ , Radek INDRA , Petr HODEK , Eva FREI ,                                                                     3                                                     Volker M. ARLT                 1   Department of Biochemistry, Faculty of Science, Charles University in Prague, Albertov 6,                   128 43 Prague 2, Czech Republic                 2                   Division  of  Preventive  Oncology,  National  Center  for Tumor  Diseases,  German  Cancer                   Research Center (DKFZ), Im Neuenheimer Feld 280, 69 120 Heidelberg, Germany                3   Analytical and Environmental Sciences Division, MRC-PHE Centre for Environment and                    Health, King’s College London, London, United Kingdom                *stiborov@natur.cuni.cz                  Abstract                 Oxidation of and DNA adduct formation by benzo[a]pyrene (BaP) by rat cytochrome P450                 (CYP) 1A1 enzyme systems is stimulated by cytochrome b 5 and NADH.                  1. INTRODUCTION                Benzo[a]pyrene (BaP) is a genotoxic carcinogen that covalently binds to DNA after metabolic                 activation by cytochrome P450 (CYP) [1,2]. CYP1A1 is the most important enzyme in BaP                bioactivation  [2,3],  in  combination  with  microsomal  epoxide  hydrolase  (mEH).  First,                 CYP1A1 oxidizes BaP to an epoxide that is  then converted to a dihydrodiol by mEH (i.e.                 BaP-7,8-dihydrodiol); then further bio-activation by CYP1A1 leads to the ultimately reactive                species,  BaP-7,8-dihydrodiol-9,10-epoxide  (BPDE)  that  can  react  with  DNA,  forming                                                        2                preferentially  the  10-(deoxyguanosin-N -yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydrobenzo[a]py-                rene  adduct  [4].  BaP  is,  however,  oxidized  also  to  other  metabolites  such  as  the  other                dihydrodiols,  BaP-diones  and  hydroxylated  metabolites.  Even  though  most  of  these                 metabolites  are  the  detoxification  products,  BaP-9-ol  is  a  precursor  of  9-hydroxy-BaP-4,5-                epoxide,  which  can  form  another  adduct  with  deoxyguanosine  in  DNA  [5,6].  Therefore,                 regulation  of  CYP1A1-mediated  oxidation  of  BaP  leading  to  either  metabolites  forming                BPDE, 9-hydroxy-BaP-4,5-epoxide or the BaP metabolites that are the detoxification products                 is of major importance. In order to modulate CYP1A1-catalyzed oxidation of BaP in human,                                                              103","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  knowledge  on  such  modulation  of  the  CYP1A1  enzyme  from  suitable  animal  models  that                 might mimic oxidation of BaP in human should be investigated and the results found applied                to regulation of BaP oxidation by human CYP1A1. In fact, the first step of such investigations                 is  to  find  which  of  the  animal  model  CYP1A1  enzyme  oxidizes  BaP  similarly  to  human                CYP1A1. Recently, similarities between human and rat CYP1A1 in BaP oxidation indicating                 that rats are a suitable model mimicking BaP oxidation in human were demonstrated [7].                    However,  there  are  still  not  clearly  explained  how  an  electron  transfer  mediated  by                 NADPH:CYP  reductase  (POR)  on  CYP1A1  during  BaP  oxidation  in  the  microsomal                 enzymatic system occurs, and whether cytochrome b 5 might influence this electron transfer.                Namely, the oxygen needed for BaP oxidation is activated in the active center of CYPs by two                 electrons  transferred  from  NADPH  and/or  NADH  by  means  of  POR  and  cytochrome  b 5,                respectively  [8].  Whereas  POR  is  an  essential  constituent  of  the  electron  transport  chain                 towards  CYP,  the  role  of  cytochrome  b 5  is  still  quite  enigmatic.  Likewise,  a  potential  of                NADH as a donor of electrons to the CYP-mediated reaction cycle is still not exactly known.                 Even though the second electron in the CYP reaction cycle might also  be provided by the                 system  of  NADH:cytochrome b 5 reductase, cytochrome b 5  and NADH, there is  still rather                enigmatic  whether  this  system  might  participate  in  donation  of  the  first  electron  to  CYP.                 Therefore,  here  we  investigated  the  effect  of  cytochrome  b 5  and  NADH  on  a  potency  of                 CYP1A1 to oxidize BaP to its metabolites and on formation of BaP-DNA adducts in vitro.                  2. MATERIAL AND METHODS                Liver microsomes of uninduced rats and/or those in which CYP1A1 was induced with Sudan                 I,  and  Supersomes   isolated  from  insect  cells  transfected  with  baculovirus  constructs                 containing cDNA of rat CYP1A1 and expressing POR were used as model enzyme systems.                  3. RESULTS  AND  DISCUSSION                Rat hepatic microsomes are natural systems containing all components of a monooxygenase                 system located in a membrane of endoplasmic reticulum, CYPs, POR, cytochrome b 5, and                 NADH:cytochrome b 5 reductase, in addition to mEH. Rat hepatic microsomes oxidized BaP                to  BaP-9,10-dihydrodiol,  the  unknown  metabolite  Mx,  BaP-7,8-dihydrodiol,  BaP-4,5-                 dihydrodiol,  BaP-1,6-dione,  BaP-3,6-dione,  BaP-9-ol  and  BaP-3-ol.  These  results  indicate                that  BaP  is  metabolized  not  only  by  CYP1A1  present  in  this  enzyme  system,  but  also  by                 mEH, which is important for the hydration of BaP epoxides to produce dihydrodiols. An up to                more than 3.5-fold increase in amounts of BaP metabolites were generated in microsomes, in                                                             104","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    which CYP1A1 was  induced.  Interestingly, the  used rat  hepatic microsomes formed in  the                 presence of NADH the same BaP metabolites as microsomes with NADPH. The amounts of                metabolites  were  also  comparable.  Rat  recombinant  CYP1A1  expressed  with  POR  in                 Supersomes  TM   oxidized  BaP  to  the  analogous  spectrum  of  metabolites  as  rat  hepatic                microsomes.  These  results  indicate  that  BaP  is  metabolized  in  this  system  not  only  by                 CYP1A1, but also by mEH. Similar to hepatic microsomes the supersomal CYP1A1 oxidized                BaP to the above mentioned metabolites even when NADH was present instead of NADPH.                 Addition  of  cytochrome  b 5  to  the  supersomal  CYP1A1  system  led  to  a  more  than  2-fold                 increase  in  BaP  oxidation  to  its  metabolites;  the  highest  increase  in  formation  of  BaP-                7,8,dihydrodiol, BaP-9,10-dihydrodiol and BaP-3-ol was found.                     In further experiments, the formation of BaP-derived DNA adducts was investigated in the                same enzymatic systems. In ex-vivo incubations containing hepatic microsomes of control and                 Sudan I-pretreated rats, DNA, BaP and NADPH generated two major DNA adducts detectable                    32                by  P-postlabeling  [6].  Induction of CYP1A1 by  Sudan  I  resulted in  a  more than 25-fold                increase in total DNA adduct levels. Similar to formation of BaP-metabolites, also the BaP-                 DNA  adducts  were  generated  in  the  microsomal  system  containing  NADH  instead  of                NADPH. Activation of BaP by rat CYP1A1 reconstituted with POR in the presence of DNA                 and NADPH resulted in formation of only one BaP-DNA. Therefore, this adduct is formed by                 CYP1A1-catalyzed oxidation of BaP alone, without the contribution of mEH. This adduct was                tentatively identified as the adduct derived from a reaction of deoxyguanosine in DNA with 9-                 hydroxy-BaP-4,5-epoxide [5,6]. Addition of mEH to the ex-vivo incubation containing BaP,                CYP1A1  reconstituted  with  POR  and  NADPH  resulted  in  formation  also  another  adducts,                                              2                which was identified as dG-N -BPDE [6]. The question whether the substitution of NADPH                by NADH influences BaP-DNA adducts formation by the CYP1A1-reconstituted system is                 planned  to  be  answered. Addition  of  cytochrome  b 5  to  the  CYP1A1-reconstitution  system                 stimulated the formation of both  BaP-DNA adducts, but their levels depended on ratios of                CYP1A1:POR:mEH:cytochrome b 5.                  4. CONCLUSION                 The results demonstrate that the POR-mediated electron transfer from NADPH to CYP1A1 is                stimulated by cytochrome b 5 and suggest that NADH can, to some extent, substitute NADPH                 as an electron donor for the CYP1A1-reaction cycle catalyzing oxidative activation of BaP.                 5. ACKNOWLEDGEMENT                The work has been supported by GACR (P303/10/G163).                                                             105","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  6. REFERENCES                 [1]IARC: IARC Monographs of Evaluation of Carcinogens. Risk of Chemicals for Human, 92 (2010), 1-853                [2]Baird WM, Hooven LA, Mahadevan B: Environmental and Molecular Mutagenesis, 45 (2005), 106–114                [3]Hamouchene H, Arlt VM, Giddings I, et al.: BMC Genomics, 12 (2011), 333                 [4]Phillips DH, Venitt S: International Journal of Cancer, 131 (2012), 2733-2753                [5]Fang  A.H.,  Smith  W.A.,  Vouros  P.,  et  al.:  Biochemical  and  Biophysical  Research  Communication,  281                (2001) 383-389                [6]Stiborová M., Moserová M., Cerná V., et al.: Toxicology, 318 (2014) 1-12                [7]Indra R., Moserova M., Sulc M., et al.: Neuro Endocrinology Letters, 34 Suppl. 2 (2013) 55-63                 [8]Coon MJ: Nutrition Review, 36 (1978), 319-328                                                                                                     106","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      ARYL HYDROCARBON RECEPTOR LIGANDS BENZO[A]PYRENE,                          ELLIPTICINE AND SUDAN I INDUCE EXPRESSION OF                 CYTOCHROME P450 1A1, NAD(P)H:QUINONE OXIDOREDUCTASE 1                                               AND CYTOCHROME B                                                                            5                                                                                                         1                                                        1                                     1*                                                                                 1                 Marie STIBOROVÁ , Iveta MRÍZOVÁ , Michaela MOSEROVÁ , Helena DRAČÍNSKÁ ,                                                     1                                                                2                                        Věra ČERNÁ , Eva FREI , Volker M. ARLT     3                 1                   Department of Biochemistry, Faculty of Science, Charles University in Prague, Albertov                   2030, 128 43 Prague 2, Czech Republic                2                   Division  of  Preventive  Oncology,  National  Center  for Tumor  Diseases,  German  Cancer                   Research Center (DKFZ), Im Neuenheimer Feld 280, 69 120 Heidelberg, Germany                 3   Analytical and Environmental Sciences Division, MRC-PHE Centre for Environment and                    Health, King’s College London, London, United Kingdom                   *stiborov@natur.cuni.cz                   Abstract                Utilizing  the  Western  blotting  and  the  real-time  polymerase  chain  reaction  (RT-PCR)                 methods, expression of cytochrome P450 1A1 (CYP1A1), NAD(P)H:quinone oxidoreductase                1 (NQO1) and cytochrome b 5 proteins and mRNAs, respectively, was found to be induced by                 treating rats with three aryl hydrocarbon receptor ligands, benzo[a]pyrene (BaP), ellipticine                and Sudan I. Because these chemicals induced the expression levels of the enzymes essential                 for  their  oxidation  dictating  their  biological  activities  (CYP1A1  and  cytochrome  b 5),  they                 exert concerted regulatory control on their own genotoxic and/or pharmacological effects.                  1. INTRODUCTION                Cytochromes b 5  are heme proteins, which are capable of accepting and transferring a single                 electron  [1].  One  of  cytochromes  b 5,  which  is  located  in  the  membrane  of  endoplasmic                reticulum (microsomal cytochrome b 5), is involved in fatty acid desaturation, cholesterol and                 plasmalogen biosyntheses  as well as in various hydroxylation reactions catalyzed by mixed                 function oxidase system [2,3]. It  can accept  an  electron from either  NADH:cytochrome b 5                reductase or NADPH:cytochrome P450 (CYP) reductase [3,4] and then reduced cytochrome                 b 5 transfers this electron to CYPs and other enzymes. The role of microsomal cytochrome b 5                in  catalytic  function  of  CYPs  has  not  been  fully  understood  yet.  Cytochrome  b 5  has  been                                                              107","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  shown to  be able to  stimulate, inhibit or have no effect  on CYP mediated reactions (for a                 review, see [2-4]). One  of hypotheses trying to  explain the influence of cytochrome b 5 on                CYP reactions suggests a role of cytochrome b 5 in a direct transfer of the second electron to                 the CYP enzyme, which is considered to be the rate limiting step in the catalytic cycle of the                CYP monooxygenase reaction [4]. The electron transfer from reduced cytochrome b 5 to CYP                 is  faster  than  the  input  of  electron  from  NADPH:CYP  reductase  [5].    Another  possible                mechanism of the cytochrome b 5 action is the formation of a complex between cytochrome b 5                 and CYP, which can receive two electrons from NADPH:CYP reductase in a single step, one                 for  reduction  of  CYP  and  another  for  that  of  cytochrome  b 5  [3].  While  CYP  without                cytochrome  b 5  has  to  undergo  two  separate  interactions  with  NADPH:CYP  reductase  to                 complete one catalytic cycle, in the case of the presence of cytochrome b 5, only one single                interaction of complex of CYP and cytochrome b 5 with NADPH:CYP reductase is sufficient;                 cytochrome  b 5  provides  the  second  electron  to  CYP  promptly  after  oxygen  binding.                Interaction  of  cytochrome  b 5  with  CYP  may  also  induce  conformational  changes  in  CYP                 proteins  leading  to  breakdown  of  oxygenated  hemoprotein  complex  with  substrates  to                 products.  This  hypothesis  is  based  on  findings  showing  that  not  only  holoprotein  of                cytochrome  b 5,   but  also  its  apo-form  (devoid  of  heme),  which  is  not  capable  of  electron                 transfer, can contribute to stimulation effects [3-5].                     It is clear from such investigations that expression levels of cytochrome b 5 in a cell are                crucial  for  efficiencies  of  several  CYPs  to  oxidize  xenobiotics.  This  is  also  true  for  the                 oxidation  of  the  anticancer  drug  ellipticine  and  the  carcinogens  benzo[a]pyrene  (BaP)  and                Sudan  I  (1-phenylazo-2-hydroxynaphtalene);  their  oxidation  by  CYP1A1,  dictating  their                 biological effects, is strongly influenced by cytochrome b 5 [6-10]. Therefore, here the effect                of BaP, ellipticine and Sudan I on expression of  cytochrome b 5 protein in rats in vivo was                 investigated. Their potency to induce the CYP1A1 and NQO1 enzymes was also investigated.                  2. MATERIAL AND METHODS                 Male Wistar rats were treated intraperitoneally with BaP, ellipticine and Sudan I as described                previously [7-10]. Microsomes were isolated from the livers and kidneys of this animal model                 [9].  The  method  of  Western  blot,  employing  anti-rat  CYP1A1,  NAD(P)H:quinone                 oxidoreductase 1 (NQO1) and cytochrome b 5 antibodies, was utilized to evaluate expression                of these proteins. Their mRNA contents in rat liver and kidney measured using the real-time                 polymerase chain reaction (RT-PCR) were also carried out [7-10].                                                               108","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    3. RESULTS  AND  DISCUSSION                 Using a method of Western blotting with antibodies raised against rat CYP1A1, NQO1 and                cytochrome b 5 and a RT-PCR method, the effects of exposure of rats to BaP, ellipticine and                 Sudan  I on  expression levels  of mRNA  and proteins  of these enzymes  were  analyzed. We                found that these compounds act as inducers of cytochrome b 5 in liver and kidney of rats. Here,                 the mechanism of such induction was investigated. Beside a potency of BaP, ellipticine and                Sudan I to induce cytochrome b 5, they also induced enzymes that are regulated by activation                 of the aryl  hydrocarbon receptor (AHR), CYP1A1 and NQO1, both  at  mRNA and protein                 levels. This finding corresponds to their ability to act as AHR ligands.                      Up  to  5-,  10-  and  100-fold  increases  in  NQO1,  cytochrome  b 5  and  CYP1A1  protein                 expression levels, respectively, were caused by treatment of rats with these compounds. The                increase in protein levels was paralleled by an increase in mRNA expression in most cases.                 Because  of  the  induction  of  cytochrome  b 5  by  the  tested  xenobiotics  in  parallel  to  that  of                CYP1A1 and NQO1, an analogous induction mechanism via the activation of AHR might be                 suggested.  Nevertheless,  further  studies  investigating  the  effects  of  AHR  expression  on                 induction of these proteins are needed to be performed to support this suggestion.                  4. CONCLUSION                       Utilizing the Western blotting method, expression of CYP1A1, NQO1 and cytochrome                b 5 protein was found to be induced by treating rats with BaP, ellipticine and Sudan I. Since                 these compounds induced the expression levels of the enzymes essential for their oxidation                dictating  their  biological  activities  (CYP1A1  and  cytochrome  b 5),  they  exert  concerted                 regulatory control on their own genotoxic and/or pharmacological effects.                  5. ACKNOWLEDGEMENT                 The work has been supported by Grant Agency of the Czech Republic (P301/10/0356) and                Charles University in Prague (UNCE 204025/2012 and 640712).                  6. REFERENCES                 [1]Velick SF, Strittmatter P: Journal Biological Chemismy, 221 (1956), 265-275.                [2]Vergeres G, Waskell L.: Biochemie, 77 (1995), 604-620.                [3]Schenkman JB, Jansson I: Pharmacology and Therapy, 97 (2003), 139-152.                [4]Guengerich FP:, Archives of Biochemistry and Biophysics, 440 (2005,) 204-211.                [5]Schenkman JB, Jansson I: Drug. Metabolism Review, 31 (1999), 351-364.                 [6]Aimová D., Svobodová L., Kotrbová V., et al.: Drug Metabolism and Disposition. 35 (2007), 1926-1934.                                                            109","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  [7]Arlt VM, Stiborová M, Henderson CJ, et al.: Carcinogenesis, 29 (2008), 656-665.                [8]Kotrbová V., Mrázová B., Moserová M., et al.: Biochemical Pharmacology, 82 (2011), 669-680.                [9]Vranová I, Moserová M, Hodek P, et al.:  International Journal of Electrochemical Science, 8 (2013), 1586-                1597.                 [10]Stiborová M, Dračínská H, Martínek V, et al.: Chemical Research in Toxicology, 25 (2013) 290-299.                                                                                                           110","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                           DETERMINATION OF METHYLXANTHINES ON PENCIL GRAPHITE                                  ELECTRODES BY CYCLIC VOLTAMMETRY (CV)                                                   1                                                                       1                            Dominika MOTLOVÁ , Rudolf NAVRÁTIL , Libuše TRNKOVÁ             1,2*                1                   Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, CZ-625 00                   Brno, Czech Republic                2     Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technická                   3058/10, CZ-616 00  Brno, Czech Republic                 *libuse@chemi.muni.cz                  Abstract                This  work  deals  with  voltammetric  determination  of  xanthine  (Xan)  and  its  methylated                derivatives  (1-,  3-,  7-,  and  9-mXan)  in  the  presence  of  copper  ions,  which  form  in  situ                 complexes  with  corresponding  xanthines  and  enable  more  sensitive  detection  of  these                substances by voltammetric methods on pencil graphite electrodes (PeGE). To enhance the                 sensitivity of detection we used the elimination voltammetric procedure (EVP), which is able                to increase oxidation signals and to uncover the minor processes of the reaction.                  1. INTRODUCTION                Xanthine  and  its  methyl  derivatives  are  biologically  important  substances  and  their                 concentration, particularly in urine, can be a suitable indicator of various types of diseases [1-                2]. Monovalent copper allows the formation of the Cu(I)-purine complex, which provides in                 voltammetric  measurements  (LSV  -  Linear  Sweep  Voltammetry)  anodic  response  at  a                potential of around 0.4 V, while there is a simultaneous increase in the oxidative signal of the                corresponding purine during detection [3,4]. For a simple, sensitive and fast electrochemical                 detection of methylxanthines on pencil graphite electrodes (PeGE) in the presence of copper,                we  used  adsorptive  stripping  techniques  in  connection  with  the  elimination  voltammetric                 procedure (EVP) [5]. The entire elimination procedure was described in several earlier works                [6-8]  and  enables  us  to  eliminate  some  current  components  while  others  are  maintained.                These techniques were proven to be a useful tool in the study of the oxidation process because                 of their easy instrumentation and very small consumption of controlled substances [9].                In  this  work  we  studied  the  redox  behavior  of  the  methyl  derivatives  of  xanthine;  the                 formation of complexes of Cu(I)-methylxanthine and the influence of the methyl group on the                redox behavior was also investigated at different pH and solution composition. The acquired                 knowledge  was  used  to  design  a  procedure  that  combines  in  situ  formation  of  the  purine                complex with monovalent copper ions on the surface of PeGE and the adsorptive stripping                                                                111","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  technique coupled with the elimination procedure for qualitative and quantitative analysis of                these substances and subsequently for its use in medicine and pharmacy.                  2. MATERIAL AND METHODS                All measurements were performed on an Autolab PGSTAT30 potentiostat (Metrohm, Czech                 Republic) using a three-electrode system with an auxiliary platinum electrode, the reference                Ag/AgCl/KCl  (3M)  electrode  and  a  pencil  graphite  electrode  (PeGE,  diameter  0.5  mm,                                      2                surface  area  16  mm )  from  Tombow  (Japan)  as  the  working  electrode.  The  chemicals                including xanthine (Xan) and its methyl derivative (1-, 3-, 7- and 9-mXan) were purchased                 from Sigma-Aldrich. Before the measurements, all graphite electrodes were activated in 0.1                M acetate buffer, pH 5.1, using a 30-second pulse insertion at a potential of 1.4 V. For CV                measurements  we  used  a  potential  between  -0.1  V  and  1.4  V  with  120  s  adsorption  at  a                 potential of -0.15 V. To calculate the elimination E4 functions (f(I), equation 1) we used the                average values of the currents of three independent CV measurements (scan rates 200, 400                 and 800 mV/s). More information can be found in a previous publication [6].                                      (f  ) I  11 . 657 I vref /  2  17 . 485 I vref  . 5  8284 I 2 vref                       (1)                 where I vref is an LSV curve scanned at the reference scan rate, I vref /2 and I 2vref  are scan rates of                 the half and twice the value of the scan rate.                  3. RESULTS  AND  DISCUSSION                A typical record of the elimination procedure has the form of f(I) vs. the E and elimination function is                shown in Fig. 1. The elimination function E4 (Equation 1) is the eliminating kinetic and                capacitycurrent component and conserves the diffusion current component [6-8].                                       Fig. 1. Elimination (EVP E4) curves of 20 µM Xan without 20 µM Cu(II) and with 20 µM Cu(II)                ions; reference scan rate 0.4 V/s, acetate buffer pH 5.1.                                                                112","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    The electroactive substance in the adsorbed state provides or accepts an electron, and we can observe a                specific  signal  in  the  form  of  peak-counterpeak.  Compared  with  LSV  the  elimination  procedure                provides a significantly increased signal in the absence or presence of Cu (II).                  4. CONCLUSION                The  electrochemical  analysis  of  xanthine  (Xan)  and  its  methyl  derivatives  (mXan)  was                performed on pencil graphite electrodes (PeGE) in the presence of copper ions using linear                 sweep  voltammetry  (LSV)  in  combination  with  the  adsorptive  stripping  voltammetric                technique and the elimination procedure (EVP) to increase the sensitivity of detection. The                 analysis  of  mXan  is  based  on  the  electrochemical  surface  modification  of  PeGE  by                monovalent  copper  and  formation  of  complex  Cu(I)-mXan,  which  is  formed  by  in  situ                 reduction of the copper ions Cu(II) by anodic polarization of PeGE and allows determination                of methylxanthines with the use of EVP. In accordance with the theory the peak-counterpeak                 signals arising after the use of elimination procedures reveal that the charge transfer process is                mediated by particles in the adsorbed state and in addition an EVP significantly increasing the                detection sensitivity and reducing the detection limits (nanomolar concentrations).                  5. ACKNOWLEDGEMENT                 The work has been supported by projects: (a) MUNI/A/0972/2013 and (b) KONTAKT II (LH                13050) of the Ministry of Education, Youth and Sports of the Czech Republic, (c) CEITEC –                Central European Institute of Technology Project CZ.1.05/1.1.00/02.0068.                  6. REFERENCES                 [1]    Scheindlin S.: Mol. Intervent. 7, (2007) 236-242.                [2]     Goyal R.N., Thankachan P.P., Kumar N., Sangal A.: Indian J. Chem. 39, (2000) 953-963.                [3]    Ibrahim  M.S.,  Temerk Y.M.,  Kamal  M.M., Ahmed  G.A.W.,  Ibrahim  H.S.M.:  Microchim. Acta.  144,                       (2004) 249-256.                [4]      Aladag N., Trnkova L., Kourilova A., Ozsoz M., Jelen F.: Electroanalysis. 22, (2010) 1675-1681.                [5]    Jelen  F.,  Hason  S.,  Trnkova  L.,  in:  Utilizing  of  Bio-Electrochemical  and  Mathematical  Methods  in                       Biological Research (Adam V., Kizek R., eds.), chap. 8. Research Signpost, Kerala, India, 2007.                [6]    Trnkova L., Kizek R., Dracka O.: Electroanalysis. 12, (2000) 905-911.                [7]    Trnkova L.: J. Electroanal. Chem. 582, (2005) 258-266.                [8]     Trnkova  L.,  in:  Utilizing  of  Bio-Electrochemical  and  Mathematical  Methods  in  Biological  Research                       (Adam V., Kizek R., eds.), chap. 4. Research Signpost, Kerala, India, 2007.                [9]    Navratil R., Pilarova I., Jelen F., Trnkova L.: Int. J. Electrochem. Sci. 7, (2013) 4397-4408.                                                                  113","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  TRENDS IN DEVELOPMENT OF FUNCTIONAL NANOSTRUCTURED                                                          FILMS                                         1*                                                                                                  2                                                                 1                                                                                   1                        Andrej ORIŇÁK , Renáta ORIŇÁKOVÁ , Ondrej PETRUŠ , Ján MACKO ,                                                             3                                         Branislav ERDELYI , Patrik STRAŇÁK      1                1                   Department of Physical Chemistry, Faculty of Natural Sciences, P.J.Šafárik University in Košice, Moyzesova                   11,041 54Košice, Slovak Republic                2  Department of Physical Chemistry, Faculty of Sciences, Komensky University Bratislava, Mylnská dolina II,                   Bratislava, Slovak Republic                3  Deapartment of Physics, Faculty of Natural Sciences, P.J.Šafárik University in Košice, Moyzesova 11,041                   54Košice, Slovak Republic                    *andrej.orinak@upjs.sk                 Abstract                 Nanostructured surfaces pose, in many cases like functional layers – they feature with specific                fiction/s. It is due to nanospecific phenomenons resulting in analytical signal enhancement,                 specific  optical  properties,  separation  abilities  or  capturing  of  analytes,  leading  an  electric                current or catalyse specific reactions. The use of these metallic nano/microstructures in many                 applications (surface enhanced Raman spectroscopy (SERS) and separation ability) has been                studied.  Free-template  electrodeposition  is  used  for  the  synthesis  of  metallic                 nano/microstructures  on solid substrates in  order to  facilitate their practical  applications as                 nanobuilding  blocks  for  plasmonic  films,  nanoseparation/filtration  or  capturing  media                followed with an integration of functional films into nanodevices. This contribution reviews a                 recent trends in this field of science.                  1. INTRODUCTION                 Electrochemical deposition of nanostructured functional films means to create well-ordered                 nanostructured  surfaces  ,  compact  layers  and  microdevices,  featuring  exquisitely  defined                geometry  and  morfology,  controlled  surface  chemistry,  and  tunable  physical  properties.                 Research teams are interested in materials and structures whose properties can be tuned or                optimized by variations in size, geometry, crystallinity, composition of surface. This strategy                 is applied primarily to problems related to  sensing films, cell capturing media,  mechanical                devices, biomedical materials, culture heritage surfaces, renewable energies and magnetism.                 There are a lot of results with producing metallic (Co, Ni, Co, Pt, Au, etc.) nanowires and                 nanotubes with various functionalities (e.g. fer-romagnetic, Tip Enhanced Raman Scattering,                                                               114","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    etc.) where authors use electrochemical deposition process inside high as-pect ratio membrane                 templates  (Anodic Alumina  Oxide  or  polycarbonate).  Controled  was  the  main  growth  pa-                rameters  during  the  deposition  in  order  to  tailor  crystal  structure  and  morphology  of  the                 metallic nanostructured films. Structural, electrical and mechanical properties were studied in                correlation with the synthesis conditions employed. The most electroformed components are                 nanocrystalline  and  the  use  of  templates  to  produce  homogenous  nanostructured  film  is                recommended.                   With new advances in material science, newer strategies arise that result in sophisticated                 architecture  for  chemical  separations  based  on  molecular  self-assembly.  These  processes                result  from  spontaneous  molecular  interactions  to  control  the  size,  shape,  or  surface                 characteristics  of  the  assembly,  often  resulting  in  what  is  a  highly  ordered  and  unique                structure.  These  molecular  assemblies  may  possess  nanoscale  features  as  well  as  unique                 properties  that  macroscale  materials  often  lack.  Among  those  structures  are  nanotubes,                nanocavities,  nanowires,  nanoposts,  nanocones,  nanospheres,  molecular  imprints,                 nanoparachutes  (conical  monodendrons),  and  general  nanoparticles  with  random  structures                 [1]. The integration of porous structures into microchannels is known to enable unique and                useful  separations  both  in  electrophoresis  and  chromatography.  Etched  pillars  and  other                 nanostructures have received considerable interest in recent years as a platform for creating                 microchannels with pores tailored to specific applications. Demonstrated was application of                chiral  and chevron nanostructures.  This versatility  in structural  design  could  facilitate  new                 developments in on-chip separations [2]. In this contribution we documment a recent status in                development of plasmonic films as well surface with separation ability as well integration of                 multifunctional elements into a microfluidic devices and chips.                  2. MATERIAL AND METHODS                 The  silver  nanostructured  films  were  prepared  by  electrochemical  deposition  of  silver  at                polystyrene nanosphere template  to prepare nanocavity film. Different cavities were applied                 and spectral signal enhancement in SERS as well cells encapturing have been studied. Second                 film  has  been  made  by  silver  electrodeposition  to  AAO  membráně  to  get  nanowires                nanostructured surface. The thin gold layer prepared by evaporation on AAO membrane was                 used as cathode and the platinum electrode as anode. The alumina template was dissolved in 1                 M  NaOH  for  1  hour  after  filling  the  membrane  pores  by  the  deposited  silver.  Nanosized                structure  consists  of  nanowires  25  nm  in  diameter  and  3000  nm  long.  The  mixture  of                 rhodamine  6G  and  4-  aminothiophenol  was  analysed  by  SERS  and  secondary  ion  mass                                                            115","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  spectrometry  (SIMS)  to  clarify  mechanism  of  spectral  signal  enhancement  or  separation                 ability of nanostructured films.                  3. RESULTS  AND  DISCUSSION                 General  equation  (1)  defines  parameters  of  nanostructured  surface  with  plasmonic,  SERS                signal enhancement function.                                                             z ˆ                                                               3z                                         , y                                           , z                                                                                                                                                               (1)                                       x                                   E                                                E                                                                         y ˆ y                                                                             z ˆ z                                                                    x ˆ x                                                  z ˆ                                                       E                                    out                                                  0                                                        0                                                                 5                                                            3                                                           r    r                Final energy of surface plasmon polariton formed at nanostructured film is given in a equation                (2).                                                             r   3                                             E                                                                   E                                                        0                                                                                                                                         (2)                                              SP                                                                    0                                                      2  0  r  d                 Intenzity  of  a  surface  plasmon  is  well  defined  for  spheric  nanoparticles  and  requires                corrections for a shape  different  to  a sphere. At Fig. 1 is  a micrograph of ~ 500nm  silver                nanocavity  nanostructured  film  that  allows  entrapping  of  colon  cancer  cells  and  enhances                spectral signal in SERS 10 times.                           Figure 1.: Polystyrene nanospheres litography of silver nanocavity film.                  Stronger SERS signal enhancement has been obtained with other silver nanostructured films                prepared  by  template-free  electrodeposition  method.  Nanospecific  phenomenon  attaches  4-                 minothiophenol  self-assembled  (SAM)  formation  to  make  signal  enhancement  extremely                                            12                intensit, founded at value 10  (see Table1 to copare with another films). Separation ability of                silver nanowires nanostructured films were confirmed by SIMS.                                                                   116","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Table 1: Comparison of various characterictic values in course of one year.                                                                           3                Type               of  Spectral  Signal  LOD [mol/dm ]   Spectral  Signal                Nanostructured          Enhancement                            Enhancement                Film                    SERS                                   SIMS                                                                      -8                                           5                nanoAg-PIGE             10                  R6G 10             10                                           8                                                                    -12                Au/Si nanovlákna        10                  R6G 10             100                                           12                                                                       -16                nanoAg                  10                     R6G 5.10        --                                           12                                                                      -16                nanoAg/SAM              10                    4-ATF 10         --                 4-aminothiophenol separates from rhodamine 6G in mixture by forming 4-aminothiophenol                SAM  while  rhodamine  6G  migrates  alone  along  the  silver  nanostructured  film.  Spectral                 separation has been calculated directly from SIMS spectra .                    4. CONCLUSION                Nanostructured  thin  films  feature  with  nanospecific  functionality  that  can  be  applied  in                 different  areas  of  research.  Nanoscopic  phenomenon  allows  to  introduce  novel                micro/nanosensors with detection of one molecule. Nanocavities with different diameter can                 capture migrating tumor cells and separate mixtures. Moreover, cavity down 40 nm diameter                 looks  to  be  sensitive  for  microscopic  RNA  (miRNA)  induced  at  cancer.  When  present,  it                switches  signal  at  cavity.  Integration  of  functional  nanostructures  to  micro/nanofluidic                 systems and chips couples benefits of both.                  5. ACKNOWLEDGEMENT                This research has been financialy supported by grant MŠ SR VEGA 1/0211/12 and APVV –                 0280-11.                  6. REFERENCES                 [1]  S.A.Archer-Hartmann,  L.A.Holland,  R.E.Majors:  Self-Assembled  Nanomaterials  for  Enhanced  Chemical                Separation, LC-GC International,  May 1(2011) 1-7.                [2] L.W. Bezuidenhout, N. Nazemifard, A.B.Jemer, D.J.Harrison and M.J.Brett: Lab on a chip. 11(2011)1671-                1678.                                                               117","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  BIODEGRADABLE MATERIALS FOR ORTHOPEDIC APPLICATIONS                                                    1*                                                                                            2                                                                       1                              Renáta ORIŇÁKOVÁ , Andrej ORIŇÁK , Miriam KUPKOVÁ ,                                                                                   3                                                                    2                                        Monika HRUBOVČÁKOVÁ , Ján MACKO                 1 Department  of  Physical  Chemistry,  Faculty  of  Science,  P.J.  Šafárik  University,  Moyzesova  11,  SK–04154                Košice, Slovak Republic                2                 Institute of Materials Research, Slovak Academy of Sciences, Watsonova 47, SK-040 01 Košice, Slovak Republic                3                 Department of Physical and Theoretical Chemistry, Faculty of Natural Sciences, Comenius University, Mlynská                dolina, SK-84215 Bratislava 4, Slovak Republic                *Renata.Orinakova@upjs.sk                 Abstract                Ironphosphate  coated  carbonyl  iron  powder  (Fe/P)  was  prepared  by  phosphating  method.                 Moreover,  the  Fe/P-Mn  alloy  was  produced  by  sintering  of  Fe/P  powder  mixed  with                manganese  powder.  Bare  carbonyl  iron  samples,  Fe/P  and  Fe/P-Mn  sintered  samples  have                 been tested with respect to their microstructure, and hemocompatibility. Addition of P and Mn                 resulted in higher surface inhomogeneity, porosity and roughness. All the samples were found                to be hemocompatible.                  1. INTRODUCTION                 The  degradable  biomaterials  have  been  proposed  as  a  novel  class  of  highly  bioactive                biomaterials which are expected to disappear via corrosion after providing structural support                 for  a  certain  period  of  time  depending  on  the  application  site  [1].  Metals,  ceramics  and                 polymers are the most commonly used materials in the biomedical field [2]. Metals are more                mechanically  interesting  compared  to  polymers  for  load-bearing  implants.  Two  classes  of                 metals have been mainly used: iron based [3, 4] and magnesium based alloys [5, 6].                       The aim of  the present  work was  to  investigate the usability of iron based sintered                 materials  as  a  potential  degradable  biomaterial.  The  effect  of  iron  phosphate  coating  of                 carbonyl  iron  powder  and  manganese  addition  on  the  microstructure  and  in  vitro                biocompatibilities of sintered materials has been evaluated in this study.                  2. MATERIAL AND METHODS                 Materials preparation and characterisation                 The carbonyl iron powder (type CC, d50 value 3.8 – 5.3 μm) was used for the experiments as                a  starting  material.  Carbonyl  iron  powders  were  coated  in  phosphating  solution  using  the                                                               118","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    modified  precipitating  method.  Phosphated  iron  powders  were  dried  and  calcined  in  air.                 Content of phosphorus in resulted sintered samples was ~ 0.5 wt.%.                The samples with addition of Mn were prepared from the mixtures of 30 wt.% of Mn powder                 (APS <10 µm, 99,6%) and carbonyl iron powder.                The powder mixtures were cold pressed at 600 MPa into cylinders (Ø 10 mm, h 2 mm) and                 sintered for 1 hour at 1120 °C in reductive H2. The samples Fe/P were sintered at 1050°C to                avoid the liquid-phase sintering.                 The  microstructure  of  the  experimental  samples  was  observed  by  a  scanning  electron                 microscope (JOEL JSM-7001F, Japan).                  Biocompatibility studies                For this purpose, 1 ml of healthy sheep blood containing sodium citrate (3.8 wt %) in the ratio                 of  9:1was  taken  and  diluted  to  10  ml  with  normal  saline.  The  haemolysis  test,  thrombus                formation test and platelet adhesion test described in details in [11] were conducted.                   3. RESULTS  AND  DISCUSSION                Figure  1  shows  the  micrographs  of  Fe,  Fe/P  and  Fe/P-Mn  samples.  Sintering  of  powder                 compacts resulted in some differences in microstructures. Small isolated pores with size up to                 1 µm are visible in microstrucure of Fe and Fe/P compacts. Approximately ten times larger                pores occur in Fe/P-Mn samples.                             Fe                      Fe/P                    Fe/P-Mn                         Figure 1.: Carbonyl iron based sintered material prepared by powder metallurgy: Fe, Fe/P,                Fe/P-Mn.                  The calculated values of hemolysis percentage were 7.00%, 5.33% and 3.96% for Fe, Fe/P                 and  Fe/P-Mn  samples,  respectively.  Addition  of  P  and  Mn  to  the  iron  powder  resulted  in                 lowering of hemolytic activity compared to pure iron sample. All the experimental samples                can all be categorized as hemocompatible and Fe/P-Mn sample can be categorized as highly                 hemocompatible.                                                              119","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  The slight decrease in thrombus formation was observed for the sintered material prepared                 from phosphated iron powder as compared with bare iron sample. Addition of Mn resulted in                significant decrease of thrombus weight.                 Fig. 2 shows representative SEM images of platelets adhering to the experimental samples. It                is clearly visible that more platelets were present on the bare iron surface as compared with                 the Fe/P and Fe/P-Mn materials. Platelets adhering to the iron surface have more afinity to the                metal surface and form pseudopodia-like structures whereas those present on the surface of                 Fe/P and Fe/P-Mn samples maintained their integrity, as shown by arrows.                                       Fe                    Fe/P                  Fe/P-Mn                 Figure  2.:  SEM  images  of  platelets  adhering  to  the  different  carbonyl  iron  based  sintered                material prepared by powder metallurgical method: Fe, Fe/P, and Fe/P-Mn.                  4. CONCLUSION                 Iron based sintered material was fabricated via powder sintering method. The samples with                 addition of phosphorus and Mn were manufactured to increase the hemocompatibility.                  5. ACKNOWLEDGEMENT                The  authors  wish  to  acknowledge  financial  support  from  the  Slovak  Research  and                 Development  Agency,  Project  APVV-0677-11  and  Grant  Agency  of  the  Ministry  of                Education of the Slovak Republic, Grant No. 1/0211/12 and grant VVGS-2013-114.                   6. REFERENCES                [1]Wegener B, Sievers B, Utzschneider S, et all.: Materials Science and Engineering B. 176 (2011) 1789-1796                [2]Wang YB, Xie XH, Li HF, et all.: Acta Biomaterialia 7 (2011) 3196-3208                [3]Schinhammer M, Hanzi AC, Loffler JF, et all.: Acta Biomaterialia 6 (2010) 1705-1713                 [4]Hermawan H, Alamdari H, Mantovani D, et all.: Powder Metallurgy 51 (2008) 38–45                [5]Levesque J, Hermawan H, Dube D, et all.: Acta Biomaterialia 4 (2008) 284–295                [6]Xin Y, Liu C, Zhang X, et all.: Journal of Materials Research 22 (2007) 2004–2011                                                                   120","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    AN ELECTROCHEMICAL STUDY OF d(GCGAAGC) DNA HEPTAMER                                      AND ITS SEQUENTIAL ANALOGUES                                   1                                                                                  2,3                                                             2,3                Iveta PILAŘOVÁ , Michaela VORLÍČKOVÁ , Iva KEJNOVSKÁ , Libuše TRNKOVÁ                   1,3*                1                   Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, CZ-625 00                   Brno, Czech Republic                2   Institute  of  Biophysics  of  the AS  CR,  v.v.i.,  Královopolská  135,  CZ–612  65  Brno,  Czech                    Republic                 3                   Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technická                   3058/10, CZ-616 00  Brno, Czech Republic                 *libuse@chemi.muni.cz                  Abstract                 DNA molecules can adopt many unusual structures (hairpins, i-motifs, G – quadruplexes and                others),  linked  with  many  neurodegenerative  diseases  (X  syndrome,  Friedreich’s  ataxia,                 Huntington’s  disease).  The  aim  of  our  contribution  is  the  electrochemical  investigation  of                different structures of DNA heptamers with AAA, CCC, GAA, GGG and TTT sequence in the                molecule center as the effect of adsorption on the electrode surface (mercury electrode, pencil                 graphite electrode).                  1. INTRODUCTION                 DNA molecules can adopt many unusual and less well characterized structures, different from                the  classical  Watson–Crick  arrangement  (B–DNA,  known  since  1953),  such  as  hairpin                 structures, i–motifs, G – quadruplexes, left–handed Z–DNA and other structures, playing an                important role in DNA functions and pathology [1, 2]. It is known that i–motifs and hairpin                structures are linked with expansion events of triplet repeat expansions, associated with many                 neurodegenerative  diseases  (X  syndrome,  Huntington’s  disease,  Friedreich’s  ataxia  or                myoclonic epilepsy) [3-5]. From this point of view, the knowledge of DNA fragment structure                 and its function in vivo is very important.  For the investigation of conformational properties                of DNA molecules, the circular dichroic spectroscopy combined with native polyacrylamide                gel electrophoresis (PAGE) is a very suitable tool [2]. Nowadays, great attention has also been                 paid to the electrochemical study of DNA  fragments and it was found that electrochemical                methods can also help in studying the primary and secondary structure of DNA fragments [5].                 The aim of our contribution  is the electrochemical  study of DNA fragments with  different                sequences in the molecule center (AAA, CCC, GAA, GGG and TTT). The different structural                arrangement  of  DNA  heptamers  studied,  revealed  by  circular  dichroic  spectroscopy  and                                                             121","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  absorption spectroscopy and verified by PAGE, was investigated by cyclic voltammetry in the                dependence of the time  of adsorption  on the  negatively  charged electrode surface, and the                 ability of the different structural arrangement reflection was monitored.                  2. MATERIAL AND METHODS                 All  electrochemical  experiments  were  performed  using  the  electrochemical  analyzer                µAUTOLAB  TYPE  III  (Metrohm,  Switzerland),  connected  with  VA  Stand  663  and                controlled  by  GPES  Manager  software.  The  samples  of  DNA  heptamers  (Integrated  DNA                 Technologies,  Inc.,  USA)  were  dosed  into  the  electrochemical  cell,  consisting  of  three                                                                                                      2                electrodes: a hanging mercury drop electrode (HMDE) with an effective area of 0.3 mm  or a                                                                                         2                pencil  graphite  electrode  (PeGE)  with  an  effective  area  of  15.9  mm   as  the  working                electrodes,  and  Ag/AgCl/3M  KCl  and  Pt  wire  as  the  reference  and  auxiliary  electrodes,                respectively. The experimental conditions for the reduction on the mercury electrode were as                                                     -1                                            -6                follows: c DNA heptamers  = 2·10  mol·L , potential range: from 0 to -1.7 V, scan rate: 200, 400                and 800 mV/s, accumulation time t a = 0 – 300 s, t = 25 °C, phosphate–acetate buffer (pH 5.8).                                                                                                 -5                                                                                                         -1                For  oxidation  on  PeGE  the  following  parameters  were  set:  c DNA  heptamers  =  1·10   mol·L ,                potential range: from -0.15 to 1.6 V, scan rate: 200, 400 and 800 mV/s, accumulation time t a =                0 – 300 s, t = 25 °C, phosphate–acetate buffer (pH 5.8).                 The voltammetric curves obtained were smoothed by using the Savitzky–Golay filter, level 2,                and the elimination voltammetric procedure EVP E4 was used and the elimination function                 E4 according to the equation f(I) = 17.485I – 11.657I 1/2 – 5.8584I 2 was calculated.                  3. RESULTS AND DISCUSSION                 At the beginning of our research we supposed that all DNA heptamers studied adopted the                hairpin  structure.  However,  later  it  was  found,  based  on  PAGE  results,  that  only  DNA                heptamers with GAA and AAA sequence in the molecule center adopt the hairpin structure. In                 the case of DNA heptamers with CCC and TTT sequence in the molecule center the duplex                structure was observed; in the case of DNA heptamer with GGG sequence in the molecule                 center, we observed supramolecular G–quadruplex structure formation. And there was a very                important question for us: Is electrochemistry able to reflect these DNA heptamer structures                on  the  negatively  charged  electrode  surface?  Based  on  the  electrochemical  results,  it  was                 found  that  the  negatively  charged  surface  of  the  mercury  electrode  is  able  to  reflect  the                structural  changes  of  DNA  heptamers  studied.  As  follows  from  Figure  1A  presenting  the                 dependence of peak current I p on the time of adsorption, the DNA heptamers with GAA and                AAA  sequence  in  the  molecule  center  (hairpin  structures)  provided  the  characteristic                isothermal  dependence,  but  in  the  case  of  DNA  heptamers  with  CCC  (duplex)  and  GGG                                                             122","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    (tetramolecular  G–quadruplex)  sequence  in  the  molecule  center,  a  different  behavior  was                observed.                                                                 0 0 0 0.08.08.08.08                   0.065.065.065                                                       GII                   0 0                                                                                       GII                                                                                       GII                                                                                       GII                         A A A                                  0 0 0 0.07.07.07.07  B B B                   0 0                   0.055.055.055                                0.06.06.06.06                                                                0 0 0                                                                                    GI GI GI GI                                                                0 0 0                   0 0                   0.045.045.045                                0.05.05.05.05                  I p(µA)  I p(µA)  I p(µA)  0.035.035.035     I(μA)  I(μA)  I(μA)  I(μA)  0.04.04.04.04  d(GC                                                                0 0 0                                                                     d(GCGAAGC)GAAGC)                   0 0                                                                0 0 0                                                                0.03.03.03.03                   0 0 0.025.025.025                                                                0 0 0                                                                0.02.02.02.02                   0 0 0.015.015.015                            0.01.01.01.01                                                                0 0 0                   0 0                   0.005.005.005                                 0 0 0 0                                                                                 - -                                                                                        -200200                                                                                                - - -                                      150                            50                            50                                 100                                           200                                                     300                                                          350                                                          350                                                     300                                           200                                                250                                                250                        0 0 0  50  100 t(s) 150150  200  250  300  350  - - - -500500500500  - - - -400400400400  -300 E(mV) -200300 E(mV) -200  -100100100100  0 0 0 0                                                                                 -300 E(mV) -300 E(mV)                                 100 t(s)t(s)                Figure 1: (A)The dependence of peak height I pI  (asterisks) and I pII  (balls) of GI and GII oxidation signals on the                time of adsorption for DNA heptamers with GAA (red), CCC (blue) and GGG (violet) sequence in the molecule                center. The GI and GII oxidation signals are presented on the Figure 1B.                Compared  to  the  mercury  electrode,  no  effect  of  the  adsorption  time  was  observed  on  the                PeGE electrode.                 4. CONCLUSION                It was found that the negative surface of the mercury electrode is able to reflect structural                differences of DNA heptamers as the effect of adsorption time, but in the case of PeGE we                were unable to detect any structural changes.                 5. ACKNOWLEDGMENTS                The work has been supported by projects: (a) MUNI/A/0972/2013 and (b) KONTAKT II (LH                13050) of the Ministry of Education, Youth and Sports of the Czech Republic, (c) CEITEC –                Central  European  Institute  of  Technology  Project  CZ.1.05/1.1.00/02.0068,  and  (d)                P205/12/0466 of the GACR.                 6. REFERENCES                [1] M. Vorlickova, I. Kejnovska, K. Bednarova, D. Renciuk, J. Kypr: Chirality, 24 (2012), 691-698.                [2] J. Kypr, I. Kejnovská, D. Renčiuk, M. Vorlíčková: Nucleic Acids Research, 37 (2009) 1713-1725.                [3] P. Padrta, R. Stefl, L. Kralik, L. Zidek, V. Sklenar: Journal of Biomolecular NMR, 24 (2002) 1-14.                [4] C.T. Ashley, S.T. Warren: Annual Review of Genetics, 29 (1995) 703-728.                [5] L. Trnkova, I. Postbieglova, M. Holik: Bioelectrochemistry, 63 (2004) 25-30.                                                                  123","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                   AROMATASE (CYTOCHROME P450 19) IS AN EFFICIENT ENZYME                              ACTIVATING ANTICANCER DRUG ELLIPTICINE                                                                         1                                                                                       2                                                                                                   3                                          1                       Jitka POLJAKOVA , Lucie BOREK-DOHALSKA , Rene KIZEK , Eva FREI ,                                                                       1*                                                    Marie STIBOROVA                1                   Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, 128 40 Prague 2, Czech                   Republic                2                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in Brno, Zemedelska 1,                   613 00 Brno, Czech Republic                3                   Division  of  Preventive  Oncology,  National  Center  for  Tumor  Diseases,  German  Cancer  Research  Center                   (DKFZ), In Neuenheimer Feld 280, 69 120 Heidelberg, Germany                   *stiborov@natur.cuni.cz                 Abstract                 Aromatase  (CYP19)  activates  ellipticine  to  form  covalent  DNA  adducts  identical  to  those                 formed  in  breast  adenocarcinoma  MCF-7  cells.  The  formation  of  CYP19-mediated-                ellipticine-DNA adducts is modulated by cytochrome b 5.                  1. INTRODUCTION                 Ellipticine is an efficient anticancer compound that functions through multiple mechanisms                (for a summary see [1-6]). The predominant mechanisms of ellipticine’s biological effects is                 its efficacy to cause DNA damage. Among them, the formation of covalent DNA adducts after                 its enzymatic activation with cytochromes P450 (CYPs) and peroxidases seems to be most                important [1-4,6]. Ellipticine oxidation to 12-hydroxy- and 13-hydroxyellipticine dissociating                 to ellipticine-12-ylium and ellipticine-13-ylium lead to formation of two major covalent DNA                                          32                adducts determined by the  P-postlabeling method (see Fig. 1) [3,4,6]. The same adducts are                also  formed,  in  rats  and  mice,  in  several  cancer  cell  lines  and  in  DNA  of  mammary                 adenocarcinoma of rats treated with this drug [3,4,6] (Fig. 1).                    Aromatase  (CYP19)  is  the  CYP  enzyme  catalyzing  the  conversion  of  the  androgenic                 substrates androstenedione, testosterone and 16-hydroxytestosterone with high specificity, and                converts  them  to  their  respective  oestrogens:  oestrone,  oestradiol  and  oestriol  [7].  As  in                 adipose tissue, stromal cells of disease-free breast express low levels of aromatase. However,                 malignant breast cancers produce large amounts of oestrogens due to high levels of aromatase                [8].  Aromatase  has  been  clearly  localised  to  both  the  malignant  epithelial  cells  and                 surrounding  fibroblasts  in  breast  tumour  tissues.  Independently  of  the  source,  oestrogen                production  in  malignant  epithelial  cells  contributes  significantly  to  tumour  growth  in  the                                                              124","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    breast.  The  clinical  relevance  of  these  findings  is  exemplified  by  the  successful  use  of                 aromatase  inhibitors  to  treat  breast  cancer  [9].  CYP19  is  also  highly  expressed  in  human                breast adenocarcinoma MCF-7 cells, which we found to be sensitive to ellipticine [3,4,6,10].                 Here, we investigated the efficiency of human CYP19 to activate this drug to species forming                covalent DNA adducts that are responsible for its cytotoxicity to MCF-7 cells.                                                                                                       32                Figure  1.:  Autoradiographic  profiles  of  ellipticine-derived  DNA  adducts  analyzed  with  the  P-postlabeling                assay. Adduct profiles obtained from DNA of from MCF-7 cells (A), from MCF-7 (Elli) cells, the cells pre-                treated with 0.1  M ellipticine for 72 h (B), exposed to 5  M ellipticine for 24 h,  from DNA incubated in vitro                with CYP19 (C), from liver of rats treated with 40 mg ellipticine/kg body weight (D), from calf thymus DNA                reacted with 13-hydroxyellipticine (E) and 12-hydroxyelipticine (F). Analyses were performed by the nuclease                               32                P1 version of the  P-postlabeling assay. Adduct spots 1-7 correspond to the ellipticine-derived DNA adducts.                Besides adduct 2 formed by 12-hydroxyellipticine, another strong adduct (spot X in panel  F), which was not                found in any other activation systems or in vivo was generated.                 2. MATERIAL AND METHODS                 MCF-7  cells  were  cultivated  as  described  previously  [10].  DNA  was  incubated  with                ellipticine,  CYP19,  NADPH  and  with  or  without  cytochrome  b 5  as  shown  in  [4,6].  The                                                                                32                formation of ellipticine-derived DNA adduct  was measured with  P-postlabeling [1-4,6].                 3. RESULTS  AND  DISCUSSION                 Two major ellipticine-DNA adducts (spots 1 and 2 in Fig. 1), generated by 13-hydroxy- and                12-hydroxyellipticine,  are  formed  in  breast  adenocarcinoma  MCF-7  cells  exposed  to                 ellipticine.  Moreover,  two  additional  minor  adducts  (adducts  spots  6  and  7  in  Fig.  1),  the                structure of them is not known, are formed in MCF-7 cells. In these cells, their pre-treatment                 with  0.1  M  ellipticine for 72 h resulted in  an increase in  formation  of  ellipticine-derived                 DNA adducts exposed thereafter to 2.5 and 5  M ellipticine for 24 h. In addition, the IC 50                 values for ellipticine in MCF-7 cells indicate that their pre-treatment with 0.1  M ellipticine                led to an increase in toxicity of ellipticine to these cells. The IC 50 value of ellipticine for the                 control (untreated) and the pre-treated cells are 1.25 and 0.7  M, respectively (Table 1).                       CYP19  activates  ellipticine  to  form  two  major  ellipticine-DNA  adducts,  identical  to                those derived from 13-hydroxy- or 12-hydroxyellipticine to levels similar to those formed by                 CYP1A1 and 3A4 (Fig. 2) [1-4,6].                                                               125","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Table 1.  DNA adduct formation by ellipticine and cytotoxicity of this agent in human MCF-7                 cells                                                                                 -7 a                                               Levels of DNA adducts (RAL x 10 )                        Cells                                                                   IC 50 ( M)                                     Adduct 1  Adduct 2  Adduct 6  Adduct 7          Total                  MCF-7                 + 2.5  M ellipticine     2.12 ± 0.21     1.38 ± 0.14   0.38 ± 0.04     0.23 ± 0.02   4.11 ± 0.41                                                                                                 1.25 ± 0.13                 + 5  M ellipticine     3.45 ± 0.35    1.59 ± 0.16   0.56 ± 0.06.   0.45 ± 0.05     6.05 ± 0.61                 MCF -7 (Elli)                  + 2.5  M ellipticine     2.95 ± 0.30   1.43 ± 0.14    0.43 ± 0.04    0.23 ± 0.02    5.04 ± 0.50 **                                                                                                0.70 ± 0.07 ***                                                                                           ***                 + 5  M ellipticine     6.37 ± 0.64    2.55 ± 0.26    0.76 ± 0.08    0.64 ± 0.06     10.30 ± 1.10                MCF-7 cells and MCF-7 (Elli), the cells pre-treated with 0.1  M ellipticine for 72 h, were                                                                                           32                exposed to 2.5 or 5  M ellipticine for 24 h. DNA adducts were analyzed by  P-postlabeling.                a                 RAL,  relative  adduct  labeling;  averages  and  S.D.  of  three  experiments.  IC 50  values  were                calculated from the linear regression of the dose-log response curves. Values are mean ± S.D.                of 3 experiments. Comparison was performed by t-test analysis; **P < 0.01, ***P < 0.001,                different from cells that were not pre-treated with ellipticine.                                  Figure  2.:  Ellipticine-DNA  adducts  formed  by  CYP19-mediated  ellipticine  activation  in  the  absence  and                presence of cytochrome b 5 .                   The formation of these adducts is dependent on concentrations of ellipticine and CYP19.                 Cytochrome b 5 modulates CYP19-mediated activation of ellipticine, increasing its activation                to reactive species forming DNA adducts.                  4. CONCLUSION                     32                The  P-postlabeling  method is a suitable tool to determine the CYP19-mediated ellipticine-                DNA adducts formed in breast adenocarcinoma MCF-7 cells.                  5. ACKNOWLEDGEMENT                 The work has been supported by  GACR (P301/10/0356) and Charles  University in Prague                (UNCE 204025/2012).                                                             126","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    3.  REFERENCES                 [1]Stiborová M., Bieler C.A., Wiessler M., et al.: Biochemical Pharmacology, 62 (2001), 1675-1684.                [2]Stiborová M., Rupertová M., Schmeiser H.H., et al.: Biomedical Papers, 150 (2006), 13-23.                [3]Stiborová M., Rupertová M., Frei E.: Biochimica et Biophysica Acta, 1814 (2011), 175-185.                [4]Kizek R., Adam V., Hrabeta J., et al.: Pharmacology \& Therapeutics, 133 (2012), 26-39.                [5]Garbett N.C., Graves D.E.: Current Medicinal Chemistry. Anti-Cancer Agents, 4 (2004), 149-172.                [6]Stiborová M., Frei E.: Current Medicinal Chemistry, 21 (2014), 575-591.                [7]Stocco C.: Steroids, 77 (2012) 27-35.                [8]Bulun S.E., Lin Z., G. Imir G., et al.  Pharmacological  Reviews, 57 (2005), 359–383.                [9]Lonning P.E.: Annul Oncology, 22 (2011), 503-514.                 [10]Borek-Dohalska  L.,  Frei  E.,  Stiborová  M.:  Collection  of  Czechoslovak  Chemical  Communication,  69                (2004) 603-615.                                                                                                       127","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                               DFT AND NMR STUDIES OF PPD ANTIOXIDANTS                                                                                           1                                                                         1                                                     1*                                Ingrid PUŠKÁROVÁ , Michal ŠTUJBER , Martin BREZA                1                   Faculty  of  Chemical  and  Food  Technology,  Slovak  Technical  University  in  Bratislava,                   Radlinskeho 9, SK-81237 Bratislava, Slovak Republic                   *ingrid.puskarova@stuba.sk                  Abstract                NMR  shifts  of  a  series  of  N-phenyl-N’-alkyl-p-phenylenediamines  in  DMSO  have  been                 measured as well as evaluated by quantum-chemical calculations. Very good correlation of                 NMR shifts of hydrogen atoms bonded to amine nitrogens with the antioxidant activity of the                studied compounds can be concluded.                  1. INTRODUCTION                 Aromatic  secondary  amines,  particularly  N-phenyl-N’-alkyl-p-phenylenediamines  (PPD)                 represent the most important group of antioxidants used in rubber industry. The antioxidant                effectiveness of a series of p-phenylenediamines in polyisoprene rubber has been studied by                 non-isothermal DSC measurements [1,2] and their molar antioxidant effectiveness (AEM) has                 been determined (Table 1).                Table  1.  Studied  antioxidants  notation  and  their  Molar  Antioxidant  Effectiveness  (AEM)                         [1,2].                                                                                                     -1                 Acronym  Compound name                                                 AEM/kg.mol                  DPPD   N,N’-diphenyl-p-phenylenediamine                                    738                   SPPD   N-phenyl-N´-(1‘-methylbenzyl)-p-phenylenediamine                    351                   6PPD   N-phenyl-N‘-(1,3-dimethyl-butyl)-p-phenylenediamine                 277                   IPPD   N-phenyl-N´-isopropyl-p-phenylenediamine                           177                   CPPD   N-(1-methyl-1-phenylethyl)-N‘-phenyl-p-phenylenediamine              0                  It is supposed that the antioxidant effectiveness depends on the bond strength of hydrogens to                 amine nitrogens between aromatic rings (N1) and at the side aliphatic chain (N2) as well as at                 its neighboring tertiary carbon. The aim of our study is to correlate the AEM values of the                above  PPD  antioxidants  with  NMR  data  obtained  experimentally  as  well  as  by  Density                 Functional Theory (DFT) calculations.                                                               128","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                 NMR analysis                All  NMR  spectra were  measured on  an Agilent  600 MHz VNMRS spectrometer equipped                 with an inverse “triple resonance” probe. Physically available samples of DPPD, SPPD, 6PPD                 and  IPPD  were  readily  soluble  in  d 6-DMSO.  Series  of  standard  homonuclear  and                heteronuclear  2D  NMR  spectra  were  measured  (including  COSY,  HSQC,  HMBC  and                15                  N­HSQC) from each of the mentioned samples in order to obtain the complete assignment                of  signals.  The  chemical  shift  scale  was  calculated  using  tetramethylsilane  (TMS)  as  an                                                                   2                internal standard and correctly referenced using the  H signal of the deuterated solvent.                Calculations                Standard B3LYP/6-311G* geometry optimizations of DPPD, SPPD,  CPPD, 6PPD and IPPD                 neutral molecules in DMSO solutions in the singlet spin states have been performed  using                Gaussian03  program  package  [6].  Solvent  effects  have  been  accounted  within  Integral                 Equation  Formalism  Polarizable  Continuum  Model  (IEFPCM)  [7].  The  stability  of    the                 resulting  structures  has  been  confirmed  by  vibrational  analysis  (no  imaginary  vibrations).                Absolute  shieldings  of  individual  atoms  have  been  calculated  by  the  Gauge-Independent                 Atomic  Orbital  (GIAO)  method  [6]  at  B3LYP/6-311++G**  level  of  theory.  NMR  shifts                relative to TMS were evaluated according to [4,5].                  3. RESULTS  AND  DISCUSSION                 The measured and calculated NMR shifts δ of hydrogen atoms bonded to N1 and N2 atoms                 are  presented  in  Table  2.  Our  results  indicate  that  they  very  well  correlate  with  the  PPD                antioxidant activity evaluated as AEM values. The parameters of linear equation                                        AEM = A + B δ(X)                                                (1)                   where δ(X) are chemical shifts of hydrogens bonded to N1 or N2 atoms are presented in Table                 2. As DPPD does not contain the N2 atom, H N1 NMR shifts have been assigned to the H N2                 ones as well. As expected, the influence of the side aliphatic chain variations on NMR shifts                of H N2 atoms is significantly higher than on the H N1 ones due to shielding by the aromatic                 ring.  The  correlation  of  the  antioxidant  activity  with  NMR  shifts  of  other  atoms  in  the                compounds under study is significantly worse.                                                               129","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Table 2. Experimental and calculated NMR shifts δ(X) (in ppm) of atoms X in the systems                         under study (see Tab. 1) and the parameters of  AEM=f(δ(X)) linear function (1).                                         Experimental                          Calculated                                                      1                                                                         1                                                                                            1                                    1                                  δ( H N2)          δ( H N1)           δ( H N2)           δ( H N1)                   DPPD            7,880             7,880              6,309              6,309                    SPPD           5,891             7,437              4,888              5,938                    6PPD           4,939             7,458              4,472              5,939                    IPPD           5,020             7,446              3,643              5,998                           -1                 A /kg.mol       -660 160        -7800 1900          -670 150          -7100 2600                          -1                 B/kg.mol         176 26          1080 250            220 30            1250 420                 Correlation       0,937             0,860              0.945              0,721                 coefficient                  4. CONCLUSION                 We  have  shown  that  NMR  shifts  of  hydrogen  atoms  bonded  to  amine  nitrogens  in  PPD                antioxidants might be used for predicting their antioxidant activity. NMR shifts can be fairly                 well evaluated by DFT calculations and so our results can be used the target synthesis of new,                 more  effective  antioxidants.  Further  theoretical  and  experimental  studies  in  this  field  are                desirable.                  5. ACKNOWLEDGEMENT                 The work has been supported by Slovak grant agency VEGA (Project No. 1/0327/12).                  6. REFERENCES                 [1]Cibulková Z, Šimon P, Lehocký P, Balko J, Polymer. Degradation and Stability, 87, (2005), 479                [2]Cibulková Z, Šimon P, Lehocký P, Balko J, Journal of Thermal Analysis and Calorimetry, 80, (2005), 357                [3]Frisch M.J., et al.: Gaussian 03, Revision C.02; Gaussian, Inc., Wallingford CT, (2004)                 [4]Blanco F, Alkorta I, Elguero J, Magnetic Resonance in Chemistry, 45, (2007), 797                [5]Silva A.M.S, Sousa R.M.S, Jimeno M.L, Blanco F, Alkorta I, Elguero J, Magnetic Resonance in Chemistry,                46, (2008), 859                [6]Wolinski K, Hilton J.F, Pulay P, Journal of the. American. Chemical. Society. 112, (1990), 8251                [7]Tomasi J, Mennucci B, Cancès E, Journal of. Molecular. Structure. (Theochem) 464, (1999), 211                                                                      130","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                         COMPUTATIONAL INSIGHT TO THE THEMODYNAMICS OF                        DOUBLE H ATOM ABSTRACTION IN MODEL PHENOLICS                                                      *                                     Ján RIMARČÍK , Erika SENAJOVÁ, Erik KLEIN                Institute  of  Physical  Chemistry  and  Chemical  Physics,  Faculty  of  Chemical  and  Food                   Technology,  Slovak  University  of  Technology  in  Bratislava,  Radlinského  9,  SK-812  37                    Bratislava, Slovak Republic                   *jan.rimarcik@stuba.sk                  Abstract                 Theoretical  DFT  calculations  of  model  aromatics  possessing  two  OH  groups  reveal  their                 thermodynamic behavior by double H atom abstractions in gas-phase, benzene and water.                  1. INTRODUCTION                 Phenolic  compounds  represent  important  group  of  natural/synthetic  free  radical  scavengers                [1,2]. They can act via three different mechanism; (i) H atom transfer, governed by O–H Bond                 Dissociation Enthalpy (BDE), (ii) electron transfer followed by proton transfer – described by                 Ionization Potential (IP) and Proton Dissociation Enthalpy (PDE), (iii) sequential proton loss                –  electron  transfer  characterized  by  Proton  Affinity  (PA)  and  Electron  Transfer  Enthalpy                 (ETE) [3,4]. Their antioxidant potential is determined by the molecular structure; compounds                with two OH groups should be more potent scavengers than phenol. Therefore, we decided to                 calculate reaction enthalpies for homolytic and heterolytic hydrogen atom abstractions from                the two OH groups in simple models of polyphenols (Fig. 1).                   2. COMPUTATIONAL DETAILS                 All  calculations  were  performed  in  Gaussian  09  program  package  [5]  using  B3LYP/6-                311++G**  approach.  For  all  studied  particles,  solvent  contribution  to  their  enthalpies  was                 estimated with integral equation formalism polarizable continuum model (IEF-PCM). Further                details and solvation enthalpies of proton and electron can be found in [6,7].                   3. RESULTS AND DISCUSSION                Reaction enthalpies of first OH group splitting-off (BDE1, IP1, PDE1, PA1, ETE1) for the                 studied  phenolics  (Fig.  1a)  are  relatively  well  explored  theoretically,  as  well  as                                                                131","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  experimentally  (BDEs)  [1,3,4].  Therefore,  chosen  computational  DFT  approach  should  be                 considered appropriate.                Consecutive  second  OH  group  splitting-off  provides  the  second  set  of  reaction  enthalpies                 (BDE2, IP2, PDE2, PA2, ETE2). Except proton affinities, PA2 values, reaction enthalpies of                 second H (homolytic or two-step heterolytic) abstraction are higher than those for the first OH                group.                 a)                               OH                          OH                            OH                                                                                               OH                                                                   OH                              OH                              (I)                            (II)                          (III)                 b)                                          OH                                    O                                                 OH                                    O                   Figure 1.: a) Structures of studied molecules: hydroquinone (I), resorcinol (II) and catechol (III); b) scheme of                studied process from parent molecule (hydroquinone) to corresponding quinone structure (para-quinone).                 In the case of hydroquinone (I in Fig. 1a), BDE2s are higher by 37 % in gas-phase to 46 % in                 water. The largest enthalpy rises are found for ETE2s, up to 119 % in gas-phase.                 Proton  loss  from  phenoxyl  radical  is  energetically  more  favorable  than  from  the  parent                molecule. PA2 values reached 93 % (gas-phase), 79 % (benzene) and 66 % (water) of PA1s.                 Two OH groups in each studied molecule allow scavenging of two free radicals. The reaction                 enthalpies of two H atom abstractions should be interpreted from the macroscopic point of                view as the average of the two steps. Table 1 present these average values for the BDE, IP and                 PA values.                 Generated  biradical  structure  after  double  H  atom  abstractions,  is  stabilized  through  the                formation  of  its  quinone  structure  (hydroquinone  and  catechol).  This  rearrangement  is                                                                 132","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                                                  –1                exothermic, for hydrochinone this enthalpy is ca –200 kJ mol  in all environments. If this                value is added to the BDE2, the drop in average BDE will be evident (Tab. 1)                     Table 1: Average values of reaction enthalpies for the three studied mechanism of double H                                                           –1                atom abstraction in hydroquinone in kJ mol . Data in parenthesis incorporate para-quinone                formalism.                                              Gas-phase      Benzene       Water                              BDE AVE         386 (172)     394 (180)    386 (175)                               IP AVE             809           694          516                              PA AVE            1403           397          179                   4. CONCLUSION                 Reaction  enthalpies  for  three  possible  mechanisms  in  gas-phase,  benzene  and  water  were                 calculated  for  simple  phenolics  bearing  two  hydroxyl  groups.  Novel  data  for  H  atom                abstraction from phenoxyl radical are presented. Solvent has strong influence on individual                 enthalpies, especially in the case of charged species. If the molecule is able to form quinone                structure  after  double  H  atom  abstraction,  further  stabilization  and  decrease  in  respective                 reaction enthalpy occurs.                  5. ACKNOWLEDGEMENT                 This  work  has  been  supported  by  the  Slovak  Grant  Agency  (VEGA  1/0735/13  and                1/0307/14).                   6. REFERENCES                [1]Vagánek A, Rimarčík J, Lukeš V, Klein E: Comput. Theor. Chem., 991 (2012), 192-200                [2]Lengyel J, Rimarčík J, Vagánek A, Klein E: Phys. Chem. Chem. Phys., 15 (2013), 26, 10895-10903                [3]Klein E, Rimarčík J, Lukeš, V: Acta Chimica Slovaca, 2, (2009), 2, 37-51                [4]Amić A, Marković Z, et al.: Food Chem., 152 (2014), 578-585                 [5]Frisch MJ, et al.: Gaussian 09, Revision C.01, Gaussian, Inc., Wallingford, CT, 2010                [6]Rimarčík J, Lukeš V, Klein E, Griesser M, Kelterer A-M: Chem. Phys., 353 (2008), 1-3, 177-184                [7]Rottmanová L, Škorňa P, Rimarčík J, Lukeš V, Klein E: Acta Chimica Slovaca, 6 (2013), 1, 60-63                                                            133","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                      ON RADICAL ANION GENERATION UPON HYDROGEN ATOM                                    TRANSFER IN DIHYDROXYBENZENES                                                      *                                     Ján RIMARČÍK , Erika SENAJOVÁ, Erik KLEIN                Institute  of  Physical  Chemistry  and  Chemical  Physics,  Faculty  of  Chemical  and  Food                Technology,  Slovak  University  of  Technology  in  Bratislava,  Radlinského  9,  SK-812  37                 Bratislava, Slovak Republic                *jan.rimarcik@stuba.sk                 Abstract                Dihydroxybenzenes  represent  model  phenolics  for  the  study  of  H  atom  transfer  from  their                 phenoxide  anions.  This  process  was  quantified  by  theoretical  DFT  approach  in  terms  of                 reaction enthalpies in gas-phase, benzene and water.                1. INTRODUCTION                 Phenolic antioxidants, both natural and synthetic, play important role in our live, mainly as                 health  protective  agents  or  industrially  used  substances  preventing  oxidation  of  various                materials [1-3]. Dihydroxybenzenes, such a hydroquinone, resorcinol and catechol (Fig. 1),                 can be considered as models of phenolics or they can also represent functional moieties of                 naturally occurring antioxidants. They react by dissociation of  phenolic O–H group, which                can  take  place  via  different  pathways  –  homolytic  or  heterolytic.  After  homolytic  H  atom                 transfer,  phenoxyl  radical  is  formed  and  its  reaction  enthalpy  is  known  as  O–H  Bond                Dissociation Enthalpy (BDE).                 Hydroxy  group  can  also  be  broken  in  heterolytic  way  –  releasing  proton  and  generating                 phenoxide  anion.  Corresponding  reaction  enthalpy  is  Proton  Affinity,  PA.  Consecutive                electron transfer from this anion leads again to the phenoxyl radical. This process is governed                 by  Electron  Transfer  Enthalpy,  ETE.  Phenols  are  considered  to  be  weak  acids,  therefore                 phenoxide  anions  can  be  expected  in  the  reaction  system,  too.  Concentration  of  anions  is                strongly dependent on the environment.                             OH                            OH                            OH                                                                                                OH                                                                   OH                             OH    (I)                                               (II)                          (III)                   Figure 1.: Structures of studied molecules: hydroquinone (I), resorcinol (II) and catechol (III).                                                              134","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Indeed,  if  formed  phenoxide  anion  contains  another  OH  group  (dihydroxybenzenes),  its                 homolytic  dissociation  is  possible.  To  distinguish  this  reaction  enthalpy  from  BDE,  we                denoted  it  as  BDE m.  This  pathway  may  be  important  in  free  radical  scavenging.  Because                 experimental  works  indicate  that  phenoxide  anions  can  abstract  H  atoms  more  easily  than                neutral  parent  molecules  [4-6],  the  goal  of  this  work  is  to  calculate  BDE m  values  for                 dihydroxybenzenes in the gas-phase, benzene and water.                 2. COMPUTATIONAL DETAILS                 All  calculations  were  performed  in  Gaussian  09  program  package  [5]  using  B3LYP/6-                311++G**  approach.  For  all  studied  particles,  solvent  contribution  to  their  enthalpies  was                 estimated with integral equation formalism polarizable continuum model (IEF-PCM). Further                 details and solvation enthalpies of proton and electron can be found in [6,7].                3. RESULTS AND DISCUSSION                 Studied reaction enthalpies, BDE m, PA, ETE and BDE, are listed in Table 1. Corresponding                 reaction scheme can be found in Fig. 2. Data in Table 1 show that BDE m values are lower                than BDEs for all three studied systems regardless on the environment (gas-phase, benzene,                 water).                                                                                               .-                                                   O                                   O                                                                     H -                                                                   BDE                                                H O                     m            O                                      H -  +               e -  -                                         PA           ETE                                OH                                                                    O                                                 H -                                              BDE                            H O                                                                 H O                Figure 2.: Scheme of possible dissociations of two O–H groups in dihydroxybenzenes.                  Here, we should note that the formation of anion is energetically demanding especially in the                                                                                  –1                hypothetical gas-phase (PAs are higher than a thousand of kJ mol ). On the other hand, in                polar  solvent  (water)  releasing  of  proton  is  more  favorable  than  H  atom  transfer  from  the                 neutral molecule, i.e. all PA(water) values are lower than corresponding BDEs. The presence                of anionic forms in the system is thus plausible.                                                                135","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                              –1                Table 1: Reaction enthalpies for dihydroxybenzenes in kJ mol .                                             hydroquinone         resorcinol       catechol                          gas-phase             219                 299              301                 BDE m    benzene               234                 309              302                          water                 241                 304              284                           gas-phase             1456                1442             1410                 PA       benzene               444                 429              403                          water                 216                 204              185                           gas-phase             326                 345              310                 BDE      benzene               329                 350              317                          water                 315                 338              309                           gas-phase             191                 226              221                 ETE      benzene               299                 335              328                          water                 298                 333              323                 The inspection of Table 1 also reveals that in the gas-phase phenoxide anions prefer to release                 electron to create the phenoxyl radical than to abstract the hydrogen atom from the second OH                group to form the radical anion. However, in the solution phase, even in non-polar benzene, it                 is vice versa, all BDE m(solv) values are lower in comparison to respective ETEs.                4. CONCLUSION                 Theoretical  calculations  suggest  that  from  the  thermodynamic  point  of  view                dihydroxybenzenes release H atom more easily from their anionic form than from the neutral                 molecule regardless on the studied environment.                 5. ACKNOWLEDGEMENT                This  work  has  been  supported  by  the  Slovak  Grant  Agency  (VEGA  1/0735/13  and                 1/0307/14).                 6. REFERENCES                [1]Vagánek A, Rimarčík J, Lukeš V, Klein E: Comput. Theor. Chem., 991 (2012), 192-200                [2]Lengyel J, Rimarčík J, Vagánek A, Klein E: Phys. Chem. Chem. Phys., 15 (2013), 26, 10895-10903                [3]Amić A, Marković Z, et al.: Food Chem., 152 (2014), 578-585                [4]Musialik M, Kuzmicz R, Pawlowski TS, Litwinienko G: J. Org. Chem. 74 (2009), 2699-2709                 [5]Jovanovic SV, Steenken S, Tosic M, Marjanovic M, Simic MG: J. Am. Chem. Soc. 116 (1994), 4846-4851                [6]Lemanska K, Szymusiak H, Tyrakowska B, Zielinski R, et al.: Free Radic. Biol. Med. 31 (2001), 869-881                [7]Frisch MJ, et al.: Gaussian 09, Revision C.01, Gaussian, Inc., Wallingford, CT, 2010                [8]Rimarčík J, Lukeš V, Klein E, Griesser M, Kelterer A-M: Chem. Phys., 353 (2008), 1-3, 177-184                                                                   136","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                           METHYLATION OF HUMIC ACIDS – THE IMPACT ON THE                           REACTIVITY STUDIED BY DIFFUSION TECHNIQUES                                                                                                    1                                   1*                                                                                1                                                       1                       Jiří SMILEK , Petr SEDLÁČEK , Martina KLUČÁKOVÁ , Michal KALINA ,                                                                    1                                                      Vojtěch ENEV                1                 Brno University of Technology, Faculty of Chemistry, Materials Research Centre, Purkyňova                464/118, 612 00 Brno, Czech Republic                *xcsmilek@fch.vutbr.cz                 Abstract                The  diffusion  cell  technique  processes  of  chosen  ionic  compounds  (basic  organic  dyes –                 Rhodamine 6G) was studied in supported hydrogel matrix for the study on reactivity of humic                 acids  (standard  samples  of  humic  acids  –  International  Humic  Substances  Society  –                Leonardite). The reactivity of humic acids was studied by interactions with basic organic dyes                 by the simple diffusion techniques realized in the diffusion cell. The rate of interactions of                humic  acids  with  chosen  organic  dye  was  compared  by  fundamental  diffusion  parameters                 such as the lag time (time needed for penetration of organic dye through hydrogel sample),                the sorption capacity of humic acids and the effective diffusion coefficients. The reactivity of                 humic acids especially sorption capacity is strongly dependent on the amount of carboxylic                 groups. The influence of carboxylic groups was modified by methylation. Carboxylic groups                became occupied by methyl groups during methylation, so the sorption capacity and the total                 reactivity of these humic acids should be lower.                  1. INTRODUCTION                 Humic acids (HA), form the key constituent  of natural organic matter in numerous natural                environments (soil, sediments). HA are one of the most important part of soil organic matter                 and  they  are  responsible  for  crucial  ecological  effects  such  as  self-detoxification  of  soils,                transport of water and nutrients etc. The interesting nature of HA stands behind the positive                 affinity to pollutants such as heavy metal ions. HA are able to form the stable complexes with                 heavy metal ions and because of this fact; they are able to immobilize these pollutants. The                function of HA in their natural environment is known very well, but the objective reactive-                 mapping tool at laboratory conditions is still missing.                The reactivity of HA is mostly studied by classical sorption experiments. Valuable parameters                 such  as  binding  capacity  and  partition  coefficients  can  be  determined  by  these  types  of                experiments. Klucakova et al. (1) realized the classical sorption experiments on HA isolated                                                               137","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  from  lignite.  But  these  experiments  have  a  few  insufficiencies.  The  reactivity  or  binding                 capacity is studied in powder form, but HA can be found in their natural environment mostly                in colloidal or hydrogel form. This paper brings the new view on the study on reactivity of                 HA. The reactivity is studied by simple diffusion techniques in supported hydrogel matrix.                The  diffusion  cell  technique  is  based  on  the  penetration  of  basic  cationic  organic  dyes                 (Rhodamine  6G)  through  the  hydrogel  matrix  with  incorporated  HA.  The  interactions                between anionic HA and cationic organic dye are expected. The rate of interactions depends                 on the nature of HA (content of acidic groups) and modification.                 The main aim of this paper is study on reactivity of standard HA samples (IHSS). The impact                of  methylation  (the  most  important  functional  groups  are  occupied  by  the  methylene)  is                 studied as well.                  2. MATERIAL AND METHODS                Modification (methylation) of HA                 The  main  objective  of  presented  paper  is  the  study  on  the  impact  of  methylation  on  the                 reacitivty of standard samples of HA. Humic acids were isolated from Leonardite by alkali                extraction according IHSS procedure. Standard samples of HA were modified by methylation.                                                                                                        3                Preparation  of  methylated  HAs  was  following:  1  g  of  HA  was  mixed  with  4  cm   of                                                       3                                 3                chloroform,  2 cm   methanol  and  4  cm   of  trimethylsilyl  diazomethane.  The  reaction  was                carried by 2 hours on vortex. Obtained product was dried at 40 °C for 2 hours under nitrogen                 atmosphere.                Preparation of IPN hydrogel                 The diffusion experiments mentioned in this paper were realized in supported hydrogel matrix                based on agarose (purchased from Sigma-Aldrich, routine class use, moisture content < 10 wt.                 %).  The preparation  of  interpenetrating  polymer  network  (IPN)  from  HA  in  a  supporting                 hydrogel-forming  polymer  based  on  agarose  was  prepared  via  thermoreversible  processes.                The network of agarose chains is interpenetrated by molecules of HA at higher temperature –                 both compounds were dissolved at 85 °C and the mixture was then filled up in pre-heated                mold.  Accurately  weighted  amount  of  agarose  powder  was  dissolved  in  deionized  water                 (preparation of pure agarose hydrogels) or in aqueous solutions of HA of the corresponding                concentration  (preparation  of  agarose/HA  hydrogels).  The  mixture  was  slowly  heated  and                 stirred continuously to 85 °C. The solution of agarose with/without HA was poured into the                 pre-heated PTFE mold and the glass slides (also pre-heated) were placed on the opposite sides                                                               138","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    of mold. The mixture of agarose with HA gradually solidified into the cylindrical hydrogel                 plate sample (40 mm in diameter and 5 mm thick).                Infrared spectroscopy of HA                 The effect of methylation was studied by infrared spectroscopy with Fourrier transformation                (Nicolet iS 50 with ATR). The infrared spectra for powder humic acids and powder modified                 humic acids were collected in tablet from potassium bromide.                Preparation of diffusion experiments                 Presented  diffusion  techniques  are  based  on  the  assumption  that  HAs  are  homogenously                 distributed  in  the  hydrogel  matrix  (non-reactive  linear  polysaccharide  agarose  hydrogel  is                used). The hydrogel in PTFE mold was placed between two chambers of diffusion cell. One                                                                 –3                chamber of diffusion cell was filled by 0.01 g·dm  Rhodamine 6G and the second chamber                                                                                                       3                was  filled  by  deionized  water.  Both  chambers  of  diffusion  cell  were  filled  by  60  cm   of                solutions simultaneously. Rhodamine 6G was purchased from Sigma-Aldrich (dye content >                95  wt.  %)  and  were  used  without  further  purification.  The  change  of  concentration  of                 diffusion  probe  is  determined  by  ultraviolet-visible  fiber  spectrometer  USB  2000+  (Ocean                 Optics, Inc.) in the receiving part of diffusion cell as the time function. The ultraviolet-visible                spectra  were  collected  continuously  in  given  time  intervals.  After  the  termination  of  the                 diffusion  experiments,  the  absorbance  in  source  part  of  diffusion  cell  was  measured.  The                 water-jacketed side-by-side diffusion cell purchased from Permegear Inc.                Determination of the fundamental diffusion parameters                 The reactivity of humic studied by simple laboratory diffusion techniques was compared by                fundamental diffusion parameters (steady-state diffusion flux, effective diffusion coefficients                 and the lag time). The values of steady-state diffusion flux and the lag time were determined                from linear region of the break through curve according equation 1.                                                                                                         (1)                   3. RESULTS  AND  DISCUSSION                Infrared spectroscopy of HA                 From  infrared  spectra  was  obvious  the  effect  of  methylation.  Carboxylic  groups  were                occupied  by  methylene  groups.  The  slower  rate  of  interaction  for  methylated  IHSS  humic                 acids was expected; because the positive affinity to cationic compounds (the immobilization                 of cationic pollutants) according literature is given mainly by carboxylic acidity.                Diffusion experiments                                                               139","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Our  previous  publications  (2,3)  clearly  illustrate  the  effect  of  interactions  between  HAs                 isolated from lignite according IHSS procedure and Methylene Blue on the transport of this                ionic dye in model aqueous environments provided by agarose hydrogel. The data presented                 in this paper continues with the same experimental approach.                It is obvious that the small  increase of concentration of HAs in 1 wt. % agarose hydrogel                 slows  down  the  rate  of  diffusion  processes.  Figure  2  summarized  the  effective  diffusion                coefficients for IHSS HA (Leonardite) samples in comparison with methylated IHSS HA for                 Rhodamine 6G. The diffusion processes of chosen organic dye is faster in agarose hydrogels                 with  modified  HA  (effective  diffusion  coefficients  have  higher  values),  because  of                methylation. Carboxylic groups are mainly responsible for sorption of heavy metal ions or                 simple organic dyes but carboxylic groups in modified samples of HA are occupied by methyl                groups and because of this fact  the binding capacity is  lower in  comparison  with  standard                 sample of IHSS HA (Leonardite).                Increasing content of HA in the hydrogel samples led to a considerable increase in absorbed                 amount of chosen dye in the hydrogel and to the decrease in steady-state diffusion flux. The                 total  content  of  HA  (also  modified)  significantly  affected  also  the  value  of  lag  time  (see                Figure 2) which indicates extensive physic-chemical interactions between diffusing organic                 dyes and HAs contained in the hydrogel. When the binding capacity is depleted all of binding                 sites  are  occupied  by  molecules  of  diffusion  probe.  Lag  time  is  indirectly  connected  with                ability of samples to retain active compounds. The influence of concentration of HAs and the                 impact of modification is proofed by different rate of interactions of HAs with Rhodamine                6G.                                   Figure  1.:  Effective  diffusion  coefficients  for  agarose  hydrogels  with  different  content  of                 humic acids (left) and the lag time of chosen diffusion probe needed for penetration through                the hydrogel for the same samples (right).                                                               140","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    4. CONCLUSION                 Diffusion cell techniques presented in this paper represent an interesting alternative approach                for the traditional reactivity mapping studies in the systems containing humic substances and                 similar reactive compounds. The presented experiments provided comprehensive illustration                of the influence of interaction between anionic HA and cationic active compounds (organic                 dyes)  on  barrier  properties  of  HAs  and  represent  valuable  approach  in  order  to  better                understanding the behavior of humic substances in their natural environments.                   5. ACKNOWLEDGEMENT                This work has been supported by Materials Research Centre at FCH BUT- Sustainability and                 Development, REG LO1211, with financial support from National Program for Sustainability                I (Ministry of Education, Youth and Sports).                  6. REFERENCES                 [1]Klučáková M, Pekař M: Colloids and Surfaces A: Physicochemical and Engineering Aspects, 286 (2006), 1-                3, 126-133.                [2]Sedláček P, Smilek J, Klučáková M: Reactive and Functional Polymers, 73 (2013), 11, 1500-1509.                 [3]Sedláček P, Smilek J, Klučáková M: Reactive and Functional Polymers, 78 (2014), 1-6.                                                                                       141","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                              ELECTROCHEMICAL SENSOR FOR CARBONATE                                                  DETERMINATION                                                                    1,2                                                                                      1,2                                                  1*                                   Filip SMRČKA , Jakub VANĚK , Přemysl LUBAL                1                   Department  of  Chemistry,  Faculty  of  Science,  Masaryk  University,  Kotlářská  2,  611  37                   Brno, Czech Republic                2  Central European Institute of Technology, Masaryk University, Kamenice 5, 625 00 Brno,                   Czech Republic                    *filip.smrcka@gmail.com                Abstract                 Specific electrochemical, spectroscopic and magnetic properties of  Ln(III) ions  make them                 perfect candidates for use in many chemical, biological and environmental systems. H 2DO2A                and  H 3DO3A  are  hexa-  and  heptadentate  ligands  forming  very  stable  complexes  with                 europium(III)  ion,  where  three,  resp.  two  coordination  places  are  occupied  by  water                molecules. These complexes form ternary complexes with small mono- and bidentate ligands                 (e.g. fluoride, acetate, phosphate, oxalate, carbonate etc.). Different stability of these ternary                complex systems can be used as a sensor for selective determination of different anions. Dual                 electrochemical-luminescent  sensor  based  on  [Eu(DO3A)(L)]  and  [Eu(DO2A)(L)]  (L  =                 picolinate,  dipicolinate,  isoquinoline-3-carboxylate)  ternary  complexes  was  developed  for                simple and rapid determination of carbonate and other relevant anions in potential biological                 samples and complicated matrixes under aerobic conditions.                  1. INTRODUCTION                 Ln(III) complexes with macrocyclic ligands (mainly DOTA derivatives) are commonly used                                         90                as radiopharmaceuticals ( Y,  153 Sm,  166 Ho,  177 Lu) or MRI contrast agents (Gd) in medicine or                as  luminescent  probes  (Eu,  Tb  in  VIS  and  Yb,  Nd  in  NIR  regions).  The  1,4,7,10-                 tetraazacyclododecane-1,7-diacetic  acid  (H 2DO2A)  and  1,4,7,10-tetraazacyclododecane-                1,4,7-triacetic acid (H 3DO3A) are hexa- and heptadentate macrocyclic ligands that yield very                 stable complexes with europium(III) ion. Both complexes also form ternary lanthanide(III)-                 containing  species  with  both  mono-  and  bidentate  ligands.  The  binary  complexes  of  the                Ln(III)-H 2DO2A and Ln(III)-H 3DO3A may be employed for determination of anions known                 to  form  the  ternary  complexes  [1].  In  this  contribution,  we  demonstrate  selective  anionic                sensors  suitable  for  carbonate  anion  determination  based  on  the  [Ln(H 2O) 2(DO2A)]  and                                                                 142","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    [Ln(H 2O) 2(DO3A)]  complexes.  The  results  shown  here  suggest  a  potential  utility  of  this                 sensor for a construction of sensor arrays.                                                                                     -                Figure 1.: Scheme of [Eu(DO3A)(picolinate)]  ternary complex.                 2. MATERIAL AND METHODS                 Cyclic  voltammetry  measurements  were  performed  on  Metrohm  910  PSTAT  mini                 (Switzerland)  using  Screen  Printed  Electrodes  (SPEs).  Luminescent  data  were  recorded  on                luminescence spectrometer Aminco-Bowman Series 2 (Thermo-Spectronic, USA).                   3. RESULTS  AND  DISCUSSION                We have focused on study of formation of ternary species with bidentate ligands (picolinate,                 dipicolinate,  isoquinoline-3-carboxylate)  having  potential  analytical  application.  The                 thermodynamic  study  of  formation  of  ternary  Eu(III)  species  was  followed  by  cyclic                voltammetry  and  luminescence  spectroscopy.  As  it  can  be  seen  on  example  of                                       -                [Eu(DO3A)(picolinate)]  (Figure 1), the formation of ternary Eu(III) complex is accompanied                by increase of fluorescence intensity and also by significant change of electrochemical signal                 (Figure  2).  Adding  hydrogencarbonate  in  solution,  the  new,  more  stable,  ternary                                   2-                [Eu(DO3A)(Carb)]  complex is formed.                                                                  143","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                 a)                                              b)                    0.5                    0.0                   -0.5               PA added                 A)     -1.0                (                I                   -1.5                  -2.0                   -2.5                       -1.6  -1.4  -1.2  -1.0  -0.8  -0.6  -0.4  -0.2  0.0                                      E (V)                                                                    -                Figure  2.:  Formation  of  [Eu(DO3A)(picolinate)]   ternary  complex  followed  by  a)  cyclic                voltammetry, b) luminescence spectroscopy.                   4. CONCLUSION                    The  bound  water  molecules  in  the  [Eu(H 2O) 2(DO3A)]  complex  undergoes  substitution                with  various  anions  to  form  stable  ternary  adducts.  The  stability  constants  values  of  the                                                                                                        2–                ternary Eu(III)-H 3DO3A-ligand complexes with bidentate ligands follow the order CO 3  >                                                  2–                                     –                                                            3–                       2–                oxalate  > picolinate  > phthalate  ≈ citrate . The proposed analytical procedure using the                                                  –                ternary complexes [Eu(DO3A)(L)]  (L = picolinate, dipicolinate, isoquinoline-3-carboxylate)                can be used for a fast, selective and sensitive determination of carbonate/bicarbonate in the                milimolar concentration range in biological and water samples.                   5. ACKNOWLEDGEMENT                This work was supported by Ministry of Education of the Czech Republic (ME09065), Grant                 Agency  of  Czech  Republic  (grants  13-08336S)  and  EU  (CEITEC  CZ.1.05/1.1.0/02.0068)                program.                  6. REFERENCES                 [1]  J. Vaněk, P. Lubal, P. Hermann, P. Anzenbacher Jr., J. Fluorescence 23 (2013) 57-69.                                                                      144","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                          FORMATION OF DNA ADDUCTS BY ELLIPTICINE AND ITS                          MICELLAR FORM IN RATS – A COMPARATIVE STUDY                                          1*                                                                    1                                                                                   1                                                                                                     2                     Marie STIBOROVA , Zuzana MANHARTOVA , Petr HODEK , Vojtech  ADAM ,                                                              2                                                                         3                                                 Rene KIZEK , Eva FREI                1                   Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, 128 40                   Prague 2, Czech Republic                2                   Department  of  Chemistry  and  Biochemistry,  Faculty  of  Agronomy,  Mendel  University  in                   Brno,  Zemedelska  1,  613  00  Brno,  and Central  European  Institute  of Technology,  Brno                   University of Technology, Technicka 3058/10, 616 00 Brno, Czech Republic                 3                   Division  of  Preventive  Oncology,  National  Center  for Tumor  Diseases,  German  Cancer                   Research Center (DKFZ), In Neuenheimer Feld 280, 69 120 Heidelberg, Germany                   *stiborov@natur.cuni.cz                 Abstract                Formation  of  covalent  ellipticine-DNA  adducts  after  the  ellipticine  enzymatic  activation  is                 one  of  the  most  important  mechanisms  of  pharmacological  action  of  this  anticancer  drug.                Here we investigated whether ellipticine might be released from its micellar (encapsulated)                 form to be able to form the covalent DNA adducts as free ellipticine. Here, we compared the                 efficiencies of free ellipticine and its micellar form [the poly(ethylene oxide)-block-poly(allyl                glycidyl ether) (PAGE-PEO) block copolymer, P 119 nanoparticles] to form ellipticine-DNA                 adducts in rats in vivo. The results demonstrate that treatment of rats with free ellipticine or                 this anticancer agent in micelles resulted in formation of ellipticine-derived DNA adducts in                vivo and suggest that a gradual release of ellipticine from its micellar form might produce the                 enhanced permeation and retention effect of this ellipticine-micellar delivery system                1. INTRODUCTION                 Ellipticine  (5,11-dimethyl-6H-pyrido[4,3-b]carbazole)  and  its  derivatives  are  efficient                anticancer compounds that function through multiple mechanisms (for a summary see [1-6]).                 The predominant mechanisms of ellipticine’s biological effects is its efficacy to cause DNA                 damage. Among  them,  the  formation  of  covalent  DNA  adducts  after  ellipticine  enzymatic                activation with cytochromes P450 (CYP) and peroxidases seems to be most important [1-4,6].                 Ellipticine oxidation to 12-hydroxy- and 13-hydroxyellipticine dissociating to ellipticine-12-                ylium and ellipticine-13-ylium lead to formation of two major covalent DNA adducts (Fig. 1)                 [3,4,6]. The same adducts are also formed, in rats and mice, in several cancer cell lines treated                with this drug and in DNA of rat mammary adenocarcinoma in vivo [3,4,6] (Fig. 1). However,                                                               145","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  this antineoplastic agent exhibits also severe adverse toxic effects, including nephrotoxicity,                 renal  toxicity,  hemolysis,  xerostomia,  hypertension,  nausea  and  vomiting  [5].  Hence,  the                studies of our laboratory are targeted on development of efficient and reliable methods for                 targeted delivery of ellipticine as well as on preparation of this drug in the forms that exhibit                lower side effects and leads to an increase in their anticancer effects.                                                                                                          32                Figure  1.:  Autoradiographic  profiles  of  ellipticine-derived  DNA  adducts  analyzed  with  the  P-postlabeling                assay.  Adduct  profiles  obtained  from  calf  thymus  DNA  reacted  with  ellipticine  and  CYP3A4  (A),  from  calf                                                                                             2                thymus DNA reacted with 13-hydroxyellipticine (B), 12-hydroxyelipticine (C),  ellipticine N -oxide (D), from                DNA of breast adenocarcinoma MCF-7 cells (E), neuroblastoma UK-NB-4 cells (F) and glioblastoma U87MG                                                                                                   i.p. with 4                mg  ellipticine  per  kilogram  body  weight  (H),  from  liver  DNA  of  C57BL/6  mice  treated  i.p.  with  10  mg                ellipticine per kilogram body weight (I), from liver DNA of Wistar rats treated  i.p. with 40 mg ellipticine per                kilogram body weight (J), from leukemia HL-60 (K) and CCRF-                from calf thymus DNA reacted with ellipticine and bovine lactoperoxidase (LPO) (M), human myeloperoxidase                (MPO) (N), ovine cyclooxygenase (COX)-1 (O) and human COX-2 (P). Adduct spots 1-7 correspond to the                ellipticine-derived DNA adducts. Besides adduct 2 formed by 12-hydroxyellipticine, another strong adduct (spot                X in panel C), which was not found in any other activation systems or in vivo was generated.                     Here,  we  utilized  ellipticine  encapsulated  in  micelles  to  study  the  biodistribution  of                 ellipticine  in  this  micellar  form  to  reach  the  tissues  in  which  the  formation  of  covalent                ellipticine-derived DNA adducts are generated. Since polymeric micelles improve solubility                 and bioavailability of hydrophobic drugs [7], they were used for ellipticine as a hydrophobic                compound.                 2. MATERIAL AND METHODS                 The poly(ethylene oxide)-block-poly(allyl  glycidyl ether) (PAGE-PEO) block copolymer (P                191  nanoparticles)  [7]  that  were  a  gift  of  Dr.  M.  Hruby  (Institute  of  Macromolecular                 Chemistry  AS  CR,  Prague,  Czech  Republic)  were  used  to  prepare  a  micellar  form  of                 ellipticine, in which ellipticine is bound by hydrophobic interactions, and to investigate its                biodistribution  among  the  tissues  of    Wistar  rats  that  are  suitable  to  mimic  the  fate  of                 ellipticine in humans [3,4,6]. The formation of ellipticine-derived DNA adducts  mediated by                                                                      32                free ellipticine and its micellar form, measured with the  P-postlabeling method [1-4,6], were                employed to determine their biodistribution in rats in vivo.                                                              146","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    3. RESULTS  AND  DISCUSSION                 In  the  present  study,  polymeric  nanoparticles  P  119  [7]  containing  hydrophobically  bound                ellipticine (0.595 mg ellipticine per ml) under the concentration of polymer of 25.9 mg per ml                                                                               32                were prepared and used for further experiments. Utilizing the  P-postlabeling assay found                previously to be suitable to detect and quantify ellipticine-derived DNA adducts formed in                 vitro and in vivo [1-4,6], their formation from free ellipticine and its micellar form (the P 119                nanoparticles) in rats in vivo was determined. Our results demonstrate that treatment of rats                 with free ellipticine or this anticancer agent in micelles resulted in formation of ellipticine-                 derived DNA adducts in liver, spleen, kidney, heart, lung and brain of rats treated with these                forms of ellipticine. Two major ellipticine-DNA adducts (see adducts 1 and 2 in Fig. 1) were                 formed in most tested organs of rats treated either with free ellipticine or its micellar form.                The results of this study indicate that both free ellipticine and ellipticine present in micelles                 are capable of transferring the biological membrane reaching the target tissues. The levels of                ellipticine-DNA  adducts  formed  in  rat  tissues  after  their  administration  with  micelles  of                 ellipticine was one order of magnitude lower in most organs than in those of rats with free                 ellipticine, with an exception of brain. In brain, the levels of ellipticine-DNA adducts formed                by ellipticine in micelles were higher than in DNA of brain of rats treated with free ellipticine.                 This  finding emphasizes that a micellar form  of ellipticine might  be employed to  treat  the                 brain tumors, treatment of which by cytostatics is usually limited because of strict selectivity                of the hematoencephalic barrier (the blood-brain barrier). The lower levels of ellipticine-DNA                 adducts  in  other  organs  suggest  a  gradual  release  of  ellipticine  that  might  produce  the                enhanced permeation and retention effect of the ellipticine-micellar delivery system.                 4. CONCLUSION                The results suggest a suitability of a micellar form of ellipticine as the drug delivery system.                 5. ACKNOWLEDGEMENT                 We  thank  Dr.  M.  Hruby  (Institute  of  Macromolecular  Chemistry  AS  CR,  Prague,  Czech  Republic)  for                preparation of P 119 nanoparticles.  The work has been supported by GACR (14-18344S in panel P301) and                Charles University in Prague (UNCE 204025/2012).                6.REFERENCES                [1]Stiborová M., Bieler C.A., Wiessler M., et al.: Biochemical Pharmacology, 62 (2001), 1675-1684.                 [2]Stiborová M., Rupertová M., Schmeiser H.H., et al.: Biomedical Papers, 150 (2006), 13-23.                [3]Stiborová M., Rupertová M., Frei E.: Biochimica et Biophysica Acta, 1814 (2011), 175-185.                [4]Kizek R., Adam V., Hrabeta J., et al.: Pharmacology \& Therapeutics, 133 (2012), 26-39.                [5]Garbett N.C., Graves D.E.: Current Medicinal Chemistry. Anti-Cancer Agents, 4 (2004), 149-172.                [6]Stiborová M., Frei E.: Current Medicinal Chemistry, 21 (2014), 575-591.                [7]Hruby M., Konák C, Ulbrich K.: Journal of Control Release, 103 (2005) 137-148.                                                              147","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  THE SITE DIRECTED MUTAGENESIS OF KEY AMINOACIDS IN THE                   HEME DISTAL SIDE OF AN OXYGEN SENSOR, YDDV, PROBABLY                  CONVERTS ITS CHARACTER FROM A O  SENSING PROTEIN TO A                                                                       2                                          HEME OXYGENASE ENZYME                                                                                           1                                       1                                                                  1*                                                                                                     1,2                    Martin STRÁŇAVA , Markéta MARTÍNKOVÁ , Marie STIBOROVÁ , Petr MAN ,                                                                                                    1                                                                              3                                                               3                                          1                      Kenichi KITANISHI , Lucie MUCHOVÁ , Libor VÍTEK , Václav MARTÍNEK ,                                                                     1                                                      Toru SHIMIZU                1                   Department of Biochemistry, Faculty of Science, Charles University in Prague, Hlavova                   (Albertov) 2030/8, Prague 2, 128 43 Czech Republic                2  Institute of Microbiology, Academy of Sciences of the Czech Republic, v.v.i., Videnska 1083,                   Prague 4, Czech Republic                                                                                    st                3   Institute of Medical Biochemistry and Laboratory Diagnostics, 1  Faculty of Medicine,                   Charles University in Prague, Czech Republic                    *marketa.martinkova@natur.cuni.cz                 Abstract                The  globin-coupled  oxygen  sensor,  YddV,  is  a  heme-based  oxygen  sensor  diguanylate                 cyclase.  Oxygen binding to the heme Fe(II) complex in the N-terminal sensor domain of this                enzyme substantially enhances its diguanylate cyclase activity which is conducted in the C-                 terminal  functional  domain.  Leu65  is  located  on  the  heme  distal  side  and  is  important  for                keeping  the  stability  of  the  heme  Fe(II)-O 2  complex  by  preventing  the  entry  of  the  water                 molecule to the heme Fe(II) complex. Since Leu65 mutations are assumed to introduce the                 water molecule into the heme distal side of the isolated heme-bound domain of YddV (YddV-                heme), it is suggested that the water molecule would significantly contribute to facilitating                 heme oxygenase reactions for the Leu65 mutants. This study suggests that mutations at the                 heme distal side could convert the characteristic properties of the heme-based oxygen sensor                into  heme  oxygenase-acting  fashion,  as  revealed  by  mass  spectrometry  and  UV-vis                 spectroscopy.                  1. INTRODUCTION                The heme-based gas sensor proteins (see [1] for a review) are composed of the N-terminal                 heme-bound  sensor  domain  and  the  C-terminal  functional  domain.  Globin-coupled  oxygen                 sensors (GCS), such as YddV, AfGcHK and HemAT with the heme-bound globin fold, have                specific characteristics. These are different from other oxygen sensors with the heme-bound                                                             148","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    PAS  fold  (Ec  DOS  and  FixL)  and  from  those  with  the  heme-bound  GAF  fold  (DevS  and                 DevT)  [1].  The  molecular  mechanism  of  YddV  action  and  its  function  is  still  not  fully                understood. Especially, the question regarding catalytic regulation by the O 2 binding to the                 heme Fe(II) complex remains to be answered. Moreover, the stability of the heme Fe(II)-O 2                complex that is important to elicit the oxygen sensor function is worthy to be studied.                  2. MATERIAL AND METHODS                 All YddV-heme proteins (WT, L65F, L65G, L65M, L65N, L65Q, L65T, Y43A, Y43F and                 Y43W)  were  prepared  by  recombinant  overexpression  in  E.  coli  cells    as  described                previously [2, 3]. Optical absorption spectral data were obtained using a HP 8453 UV-VIS                                                                            o                spectrophotometer  (Agilent  Technologies,  CA,  USA)  at  20  C  under  aerobic  conditions  as                previously described [2, 3].  UV-vis spectra of YddV-heme proteins (from 5 to 8 µM) were                 recorded in  50 mM  Tris-HCl buffer (pH 8.0) in  order to  examine the heme Fe(III), Fe(II)                (sodium dithionite reduced) and Fe(II)-CO (CO bubbled) species. A solution of 20 µM YddV-                 heme protein was used for mass spectrometric analysis of the heme status. Half a microliter                 was spotted on a MALDI plate and overlaid with 0.5 µl of a saturated solution of α-cyano-4-                hydroxycinnamic acid in methanol and water. Mass spectra were acquired on a MALDI-FT-                 ICR mass spectrometer equipped with 9.4 T superconducting magnet (Apex-Qe Ultra, Bruker                 Daltonics, Germany). Data were collected in positive ion mode over the mass range 350-1500                m/z  at  1M  data  points,  resulting  in  a  maximum  resolution  of  200,000  at  400  m/z.  The                 instrument was externally calibrated using singly-charged arginine clusters, resulting in sub-                ppm accuracy. The spectra were processed and theoretical isotopic envelopes of heme and                 verdoheme were modeled in DataAnalysis 4.0 (Bruker Daltonics).                  3. RESULTS  AND  DISCUSSION                 We aimed to shed more light on the key amino acids necessary for the O 2 binding to the heme                Fe(II) complex of YddV-heme and describe the exact role of Leu65 in the process. In order to                 study  the  YddV-heme  properties  dictated  by  the  Leu65  mutations,  we  overexpressed  and                purified the following mutants of YddV-heme, L65F, L65G, L65M, L65N, L65Q and L65T.                 Overexpression  and  purification  of  L65G  and  L65N  were  extremely  difficult  because  the                green-colored protein solution was obtained instead of the red-colored solution of a typical                 heme  protein  (Figure  1A).  The  mass  spectral  analysis  of  L65G  and  L65N  unequivocally                 proved that the major species responsible for the green color of their solutions is verdoheme                (Figure 1B).  Other modified heme complexes  such as  meso-hydroxyhemin,  biliverdin,  and                                                             149","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  bilirubin were also found, but their signals were very weak. Note that verdoheme is the first                 stable product of the consecutive heme oxygenase reactions.                                      Figure 1.: (A) The absorption spectrum of the green solution (solid line) of L65N of YddV-heme (5.0 μM) and                the  CO  added  solution  (broken  line).  CO  addition  substantially  changed  the  spectrum  of  the  purified  L65N,                 suggesting  that  the  modified  heme  Fe(II)  complex  exists  in  the  solution  without  being  reduced  by  sodium                dithionite. Sodium dithionite addition also changed the spectrum of the final solution (dotted line), suggesting                that  the  modified  heme  Fe(III)  complex  is  also  mixed  in  the  solution.  (B)  Detailed  view  of  the  mass  range                covering heme and verdoheme region. Isotopic envelopes are shown a mixture of heme/verdoheme from mutant                L65N of YddV-heme.                4. CONCLUSION                 We  confirmed  a  key  role  of  well  conserved  Leu65  in  a  heme-bound  sensor  domain  of  a                 globin-coupled oxygen sensor, YddV. While in WT of the YddV protein, O 2 interaction with                the  heme-Fe(II)  complex  is  important  for  the  oxygen  sensing  process,  mutation  at  Leu65                 probably  significantly  changed  the  character  of  the  YddV  enzyme  to  simulate  the  heme                oxygenase reaction. The tendency to simulate the heme oxygenase activity varies among the                 tested Leu65 mutants. The L65G and L65N were identified as the proteins showing the most                efficient simulation of the heme oxygenase activity.                 5. ACKNOWLEDGEMENT                 This  work  was  partially  supported  by  the  Grant-in-Aid  from  Charles  University  in  Prague                (UNCE 204025/2012), by the Grant Agency of the Czech Republic (grant P301/10/0356) and                 by the Grant Agency of the Charles University (grant 756214).                6. REFERENCES                 [1]Martinkova M., Kitanishi K., Shimizu T.: J. Biol. Chem. 288 (2013) 27702-27711.                [2]Kitanishi K., Kobayashi K., Kawamura Y., et. al.: Biochemistry 49 (2010) 10381-10393.                [3]Nakajima K., Kitanishi K., Kobayashi K.,et. al: J. Inorg. Biochem. 108 (2012) 163-170.                                                                150","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                            INHIBITORS OF CYCLIN-DEPENDENT KINASES AS NEW                                    GENERATION OF ANTICANCER DRUGS                                                                                                      1                                        1*                                                               1                                                                                1                     Miroslav STRNAD,  Vladimír KRYŠTOF,  Radek JORDA, Eva ŘEZNÍČKOVÁ,                                                1                                                                       1                                Tomáš GUCKÝ,  Marek ZATLOUKAL,  Libor HAVLÍČEK            2                1 Laboratory  of  Growth  Regulators,  Institute  of  Experimental  Botany  ASCR     Palacký                University, Šlechtitelů 11CZ-783 71 Olomouc, Czech Republic                 2                  Isotope  Laboratory,  Institute  of  Experimental  Botany  ASCR,  Vídeňská  1042,  CZ-142  20                Prague, Czech Republic,                    *miroslav.strnad@upol.cz                     Purine-based compounds have already been used in numerous applications,  inter alia as                agonists and antagonists of adenosine receptors, ligands of corticotropin-releasing hormone                 receptors, and inhibitors of numerous proteins, including heat shock proteins (HSPs), protein                 and lipid kinases, sulphotransferases and phosphodiesterases. Thus, systematic screening for                purine  derivatives  with  desired  activities  is  likely  to  be  highly  rewarding.  Originally,  we                                                                                               6                focused on the primary action mechanisms of the plant hormones cytokinins (N -substituted                adenine derivatives) in mammalian cell division cycles, and showed that natural cytokinins                                                                           1                are rather non-specific inhibitors of various protein kinases.  Surprisingly, at that time, among                aromatic  cytokinin  derivatives  we  discovered  a  compound,  2-(2-hydroxyethylamino)-6-                 benzylamino-9-methylpurine, named \"olomoucine\", which inhibits several cyclin-dependent                                                              1                kinases (CDKs) at  micromolar concentrations.  In subsequent studies the purine heterocycle                was one of the first systematically investigated scaffolds of kinase inhibitors (partly due to its                 amenability  to  various  substitutions),  leading  to  discovery  of  roscovitine,  olomoucine  II,                purvalanol A,and LGR1406, which display an enhanced inhibitory activity toward CDK1, a                 higher selectivity toward some CDKs, an increased antimitotic activity at the G1/S and G2/M                                                                                          2,3                points of the cell cycle, and stronger and more selective antitumour effects..   Roscovitine is                a pan-selective CDK inhibitor with multiple effects on cell proliferation, p53 expression and                 p53-dependent  transcription  and/or  induction  of  apoptosis  in  cancer  cells.  Consequently,                roscovitine  was  among  the  first  CDK  inhibitors  to  enter  clinical  trials.  It  was  licensed  to                 Cyclacel Pharmaceuticals and is currently being evaluated in phase 2b clinical trials with Oral                 Sapacitabine and Oral Seliciclib (see www. ClinicalTrials.gov).                       Unfortunately,  chemotherapeutic  agents  currently  used  for  treating  cancer  probably                 influence few of the abovementioned hallmarks besides their key therapeutic targets, although                                                              151","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  in many cases the effects on other cancer-related aberrations have never been tested (so they                 could  have  additional  unknown  negative  or  positive  effects).  Thus,  “hallmark”  biological                activities  should  ideally  be  tested  for  each  new  lead  substance  to  define  as  many  of  its                 pertinent biological activities as possible. For example, very little is known about the effects                of known CDK inhibitors on other cancer hallmarks. However, we recently showed that the                                                                                   5                CDK inhibitor roscovitine blocks angiogenesis in vitro and in vivo.  Furthermore, in detailed                investigation of its action mode our Munich colleagues identified a new function of CDK5 in                  endothelial cell migration and angiogenesis. Our further joint work suggests a new possible                application  of  CDK  inhibitors,  particularlyCDK5  inhibitors,  as  antiangiogenic  agents,                indicating  that  structure-activity  analyses  of  purine  analogues  could  greatly  facilitate  the                                                                       4,5                identification of potent new antiangiogenic compounds.  Some newly discovered hallmark                activities will be described in this talks as well.                                                                                              Cl                                                                       H O                                     H N               H N              H N              H N                     H N            N     N           N    N           N    N           N     N                           N              N        H N  N  N                N        H N  N  N                    N            H N  N                             H N  N                                           CH 3                        N  N         OH               OH               OH               OH                           H                Fig. 1. Chemical structures of 6-benzylaminopurine (BAP), olomoucine, roscovitine,                olomoucine II and purvalanol (from left to right).                 ACKNOWLEDGEMENTS                 We gratefully acknowledge grant no. LO1204 from Czech Ministry of Education for financial                 support to this work.                  REFERENCES                [1] Vesely J, Havlicek L, Strnad M et al, Eur. J. Biochem. 1994, 224, 771-786.                 [2] Meijer, L. et al, Eur. J. Biochem. 1997, 243, 527-536.                [3] Havlicek L, Hanus J, Vesely J et al, J. Med. Chem. 1997, 40, 408-412.                [4] Liebl J, et al, J Biol Chem. 2010 Nov 12;285(46):35932-43.                [5] Weitensteiner SB, Liebl J, Krystof V, et al,  PLoS One. 2013;8(1):e54607                                                                      152","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                             EFFECT OF DEEP FREEZING TO QUALITY OF HEK293                           TRANSFECTED WITH CA  3.1 MEMBRANE CHANNEL                                                            V                                                                                 1,4                                                             1                                                                                                        2,3                 Ondřej SVOBODA     1,2* , Larisa BAIAZITOVA , Ivo PROVAZNÍK , Jaromír HUBÁLEK                1                       Department  of  Biomedical  Engineering,  Faculty  of  Electrical  Engineering  and                Communication,  Brno  University  of  Technology,  Technicka  3082/12,  616  00  Brno,  Czech                Republic                2      Central European Institute of Technology, Brno University of Technology, Technicka                 3058/10, 616 00 Brno, Czech Republic                3      Department  of  Microelectronics,  Faculty  of  Electrical  Engineering  and                 Communication,  Brno  University  of  Technology,  Technicka  3082/12,  616  00  Brno,  Czech                 Republic                4      International  Clinical  Research  Center  -  Center  of  Biomedical  Engineeering,  St.                 Anne's University Hospital Brno, Brno, Czech Republic                *ondrej.svoboda@ceitec.vutbr.cz                 Abstract                Storing  of  living  cells  in  liquid  nitrogen  (LN 2)  has  been  a  standard  for  a  long  time.                 Disadvantages are well known – LN 2 evaporates. There is another possibility to store living                 cells  using  a  freezer  with  temperatures  of  -80  °C.  In  this  work,  we  focus  on  the  study  of                HEK293  cells  stored  in  the  low  temperature  freezer  and  evaluation  of  cell  quality.  Our                 experiments involved 190 individual cells, 87 of them frozen for ten days. Then, cells were                 thawed and their ability to establish a gigaseal in patch-clamp measurement was tested. Ten-                day freezing did not influenced quality of cells comparing to those stored in LN 2 but there                 were small differences comparing to control group of cells.                1. INTRODUCTION                 Freezing  cells  in  liquid  nitrogen  (LN 2)  with  DMSO  is  well  known  and  commonly  used                procedure  for  long  time  cell  storing.  Liquid  nitrogen  boils  at  −196  °C  and  is  used  as  a                 cryogenic  fluid  in  life-sciences.  It  causes  rapid  freezing  on  contact  with  living  tissue.                 However, small laboratories with limited number of experiments suffer from difficulties to                access and manage LN 2. Another possibility is based on an idea to freeze cells in a special                 low  temperature  freezer  with  stable  temperature  about  −80  °C.  The  main  question  is  if  i)                higher  temperature  of  deep  freezers  and/or  ii)  slower  freezing,  can  negatively  influence                 quality of the stored cells.                                                                153","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIAL AND METHODS                 HEK293 cells were used in our experiment. These cells were isolated in 1970s by Graham                and van der Eb [1]. Since 1970s, the use of HEK293 cell lines really expand especially due to                 their easy cultivation, rapid growth [2], no calcium and sodium channel expression [3] and                easy transfection [2]. HEK293 used in this experiment were transfected by Ca V 3.1 membrane                 current channel. This channel belongs to T-type (LVA) voltage gated calcium channel group.                Ca V 3.1 channel is characterized by presence of α 1 subunit with combination of other auxiliary                 β, α 2-δ and γ subunits [4], fast activation [3] and relative fast recovery from inactivation. Ca V                 3.1 can be commonly found in cardiac tissue and neurons [4], [5], [6].                Cell  quality  was  evaluated  by  standard  patch  clamp  technique.  This  electrophysiology                 technique was developed by Hamill et all [7] in 1980s. It allows the user to study membrane                potentials and channel currents. Patch clamp technique is well described in e.g. [7]. One of the                 patch clamp key step is establish a gigaseal which can be made by extra suction on hollow                glass pipette filled with solution which is similar to the intracellular fluid. The pipette is in                 well contact with measured cell before gigaseal. Cells were placed in bath solution during                 measurement. The solution is similar to the extracellular solution [8].                Cells were cultivated in EMEM with  10% FBS and 1% P/S, L-Glutamine and G-418. All                 patch  clamp  measurements  used  the  same  bath  and  pipette  solutions  to  avoid  artificial                 variability. No membrane channel blockers were used. Patch clamp pipettes were prepared                from borosilicate glass with output resistance between 2.1 and 2.8 MΩ. Experimental setup                 consisted of Axopatch 200B, Digidata 1440 and PC with Clampex software.                As the main indicator for cells quality, ability of the cell to establish gigaseal was chosen.                 Such indicator is strictly dichotomic but it is necessary for a lab using patch-clamp technique.                Non-frozen cells, cells frozen in LN 2 and cells frozen in freezer were measured separately.                 For each type of cells, gigaseal-to-total number of cells ratio was calculated.                 3. RESULTS AND DISCUSSION                Gigaseal-to-total number of cells ratio was calculated for control group and both experimental                 groups  of  cells.  The  results  are  presented  in  Table  1.  The  control  group  shows  that  about                20.4% of non-frozen HEK293 cells can be successfully gigasealed. Both experimental groups                 express roughly doubled quality. Cells frozen in a low temperature freezer can be gigasealed                in 29.0% comparing to 30.6% of cells frozen in LN 2. Table 1 shows some difference between                 the control group and frozen cell groups. It is most probably effect of improper measurement                 conditions,  ie.  measurement  solutions  quality  and  longtime  cells.  The  difference  in                gigaseal/number of cells cell ratio between frozen cells by both techniques is subtle. Freezing                                                             154","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    cells in  LN 2  and a low  temperature freezer for ten days  does  not  change cell quality.  The                 results  are  limited  by  limited  storage  time  and  the  used  type  of.  However,  the  results  are                satisfactory for the main purpose of the experimental work. Future work of the team will be                 focused on the experiments with cells frozen for periods longer than ten days. Further, Ca V                3.1 current responses will be measured as another potential quality indicator.                 Table 1: Cell statistics from individual experiments                                                     No. of cells   No. of gigaseals    Gigaseal/Cell ratio                   Non-frozen cells (control group)        103               21                  0.204                 Cells frozen in a freezer                38               11                  0.290                  Cells frozen in LN 2                     49               15                  0.306                 4. CONCLUSION                In this paper, comparison of two techniques of low temperature cell freezing is  presented.                 Subtle  differences  between  freezing  in  a  low  temperature  freezer  and  liquid  nitrogen  was                 found.  However,  difference  between  non-frozen  and  frozen  cells  caused  by  improper                measurement conditions appeared.                 5. ACKNOWLEDGEMENT                The  article  was  supported  by  grant  project  GACR  P102/11/1068,  European  Regional                 Development  Fund  -  Project  FNUSA-ICRC  (No.  CZ.1.05/1.1.00/02.0123)  and  by  projet                 FEKT-S-14-2300 A new types of electronic circuits and sensors for specific applications.                6. REFERENCES                 [1]Graham FL, van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA.                Virology. 1973, 52, 2.                [2]Thomas P, Smart TG. HEK293 cell line: a vehicle for the expression of recombinant proteins. Journal of                Pharmacological and Toxicological Methods. 2005, Vol. 3, 51.                [3]Kamaržínová M, Lacinová Ľ. Measurement of Cellular Excitability by Whole Cell Patch Clamp.                 Physiological Research. 2010, S1-S7.                [4]Catterall WA. Structure and regulation of voltage-gated Ca2+ channels. Annual Review of Cell and                Developmental Biology. 2000, 16.                [5]Catterall WA. Voltage-Gated Calcium Channels. Cold Spring Harbor Perspectives in Biology. 2010.                [6]Kostyuk P G. Calcium channels in the cell membrane. Neuroscience and Behavioral Physiology. 1986, Vol. 5,                16, pp. 401-410.                [7]Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-clamp techniques for high-                 resolution current recording from cells and cell-free membrane patches. Pflugers Archive. 1981, Vol. 2, 391.                [8]Okada Y. Patch Clamp Techniques : From Beginning to Advanced Protocols. 2012. 978-4-431-53992-6.                                                              155","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                       FLUORESCENCE STUDY OF MIXED MICELLES FORMATION                                                                                       1                                                                      1                                                      1*                                    Jana Szewieczková , Filip Mravec , Miloslav Pekař                1  Centre  for  Materials  Research,  Faculty  of  Chemistry,  Brno  University  of  Technology,                   Purkynova 118, 612 00 Brno, Czech Republic                    *xcszewieczkovaj@fch.vutbr.cz                  Abstract                An  aggregation  process  of  sugar-based  surfactant  and  phospholipid  was  studied.  All                 experiments  were  realized  by  using  fluorescence  spectroscopy  method  with  pyrene  as  a                 fluorescence probe.                At  the  beginning,  aggregation  behaviour  of  DPPC  (1,2-dipalmitoyl-sn-glycero-3-                 phosphatidylcholine)  was  studied  in  two  different  ways.  Then,  sugar-based  surfactant                (dodecyl-β-D-maltoside) aggregation was studied in the presence and absence of DPPC.                   1. INTRODUCTION                Dodecyl maltoside (in excess) can well solubilize DPPC. In the case of equimolar mixture                 was achieved complete DPPC bilayer solubilization into mixed micelles, too 0.                The dependence of mixed micelle stoichiometry on the concentration of aqueous sugar-based                 surfactant is consistent with the assumptions of ideal mixing of the two amphiphiles in the                mixed micelles 0.                 Pyrene  is  highly  sensitive  fluorescence  probe  suitable  for  studying  polarity  of  local                 environment. Intensity of first emission band is sensitive for local polarity and intensity of                third  emission  band  0  is  used  as  a  reference  and  then  we  can  use  their  ratio  as  emission                 polarity index (EmPI). This parameter is often used for CMC determination 0 and can be used                for characterization of mixed surfactant systems 0.                 Dependences of pyrene EmPI as a function on the total surfactant concentration show around                 CMC sigmoidal decrease and after fitting by sigmoidal curve to CMC obtaining. The same is                valid for ExPI (ExPI – excitation polarity index) obtained from pyrene excitation spectra as a                 ratio of intensity at 335 and 338 nm.                Nile  red  is  another  fluorescence  probe.  In  the  presence  of  aqueous  suspension  of                 phosphatidylcholine vesicles It fluorescence intensely, while its fluorescence is quenched in                 water 0.                                                                156","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                 Materials. Dodecyl-β-D-maltoside was purchased from Fluka (resp. Sigma), 1,2-dipalmitoyl-                sn-glycero-3-phosphatidylcholine  DPPC,  Fluka,  GmbH),  nile  red,  pyrene  and  chloroform                 were purchased from Fluka, GmbH. All  experiments  were performed in  water adjusted by                MiliPore system.                  3. RESULTS  AND  DISCUSSION                 CAC  (critical  concentration  of  aggregation)  of  DPPC  was  determined  by  two  different                 methods – in saturated pyrene solution and with nile red as a fluorescence probe.                In the Figure 1 are shown dependences of pyrene ExPI and total integral of nile red emission                 spectra in the range of 525–750 nm on the DPPC concentration. In the case of pyrene ExPI                and  EmPI  (EmPI  not  shown)  CACs  were  obtained  as  a  point  of  inflexion  after  fitting  by                 Boltzmann  curve,  and  concentration  at  the  first  break  of  the  Boltzmann  curve  (CBA  –                concentration of the beginning of an aggregation) was calculated. In the dependence of total                 integral of nile red emission spectra are evident two breaks, which well correspond to the first                 break of Boltzmann curve and its point of inflection.                In aqueous solution  probably  occurs transformation from  micelle-like structures  to another                 aggregates (liposomes, vesicles), begins at CBA and at CAC are these new aggregates (new                 type of aggregates) formed. All measured concentrations are listed in Table 1. As can be seen,                data  obtained  from  measurements  of  pyrene  EmPI  and  nile  red  total  integral  are  in  good                 agreement to each other. On the other hand, CBA and CAC obtained from measurements of                pyrene ExPI are slightly lower.                                                                                                          −3                For  further  measurements  of  mixed  micelles  formation,  DPPC  concentration  of  5 mg dm                (close to CBA) was chosen.                                         Figure 1.: Dependences of pyrene ExPI and Total Integral emission spectra of nile red on                the DPPC concentration                                                             157","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Table 1: CBA and CAC of DPPC.                                                                                          −3                                                                         −3                               Fluorescence  Dependence  CBA [g dm ]  CAC [g dm ]                                  probe                                  Pyrene          EmPI           0.004            0.014                                    Pyrene          ExPI           0.003            0.011                                   Nile red         Total          0.005            0.015                                                 integral                                         Average             0.004 ± 0.001    0.013 ± 0.002                   CMC  of  dodecyl-β-D-maltoside  (hereinafter  the  C12Mal)  was  determined,  and  then,                                                                  −3                behaviour of mixed system with DPPC (0.005 g dm ) was measured. Dependences of pyrene                EmPI (ExPI not shown) for both systems are shown in Figure 2.                 For pure C12Mal smooth dependences of pyrene ExPI and EmPI on C12Mal concentration                were obtained and values of CMC were received. These values are shown in Table 2. In the                 presence of DPPC decrease of EmPI (and ExPI too) was observed at C12Mal concentration                about 0.01 mM followed by its increase in the range of C12Mal concentration 0.04–0.1 mM.                 This  variation  of  EmPI  can  indicate  formation  of  premicelar  aggregates  and  their                disintegration just before CMC and micelle formation.                 These dependences were by two Boltzmann curves fitted, when the first point of inflection                 was named CAC (formation of first aggregates with hydrophobic core), and the second CMC.                Values are again shown in Table 2. It is apparent, that CMC is decreasing with addition of                 DPPC  to  C12Mal.  In  the  case  of  mixture  of  C12Mal  and  DPPC,  CAC  is  localized                 approximately at ten times lower concentration that CMC is.                                        Figure 2.: Dependences of pyrene EmPI on the C12Mal concentration of C12Mal and its                mixture with DPPC                                                             158","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Table 2: Parameters of Boltzmann curves for C12Mal and its mixture.                                                 CMC [mM]                              CAC [mM]                      System        EmPI  ExPI        Average     Literature  EmPI      ExPI      Average                      C12Mal         0.21    0.19    0.20 ± 0.01    0.17 00       -       -           -                  C12Mal+DPPC        0.16    0.14    0.15 ± 0.01       -       0.0167  0.015  0.16  ± 0.001                   4. CONCLUSION                In this paper we explained, that interaction of DPPC with non-ionic surfactant (sugar-based                 surfactant) is possible.                                                                 –3                After addition of DPPC (at concentration 5 mg dm ) to sugar-based surfactant (C12Mal) was                its CMC reduced, premicelar aggregates were probably formed and CACs of systems were                 founded.                  5. ACKNOWLEDGEMENT                This work has been supported by Ministry of Education, Youth and Sports, Project LO1211.                   6. REFERENCES                [1]Carion-Taravelal B, Chopineau J, et all.: Langmuir, 14 (1998), 14, 3767-3777                [2]Eidelman O, Blumenthal R, et all.: Biochemistry, 27 (1988), 2839–2846                                                                 rd                [3]Lakowicz, JR: Principles of Fluorescence Spectroscopy. 3  edition. Baltimore: Springer, 2006. 954                [4]Aguiar J, Carpena P, et all.: Journal of Colloid and Interface Science, 258 (2003), 116–122                [5]Hierrezuelo JM, Aguiar J, et all.: Langmuir, 20 (2004), 10419–10426                [6]Greenspan P, Fowler, SD: Journal of lipid research, 26 (1985), 781–789                [7]Hong W-X, Baker KA, et all.: Langmuir, 26 (2010), 11, 8690–8696                [8]Tsamaloukas AD, Beck A, et all.: Langmuir, 25 (2009), 8, 4393–4401                                                                           159","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                    INTERACTION OF HEAVY METALS WITH GRAPHENE AND IRON                                                  BASED PARTICLES                                                                     1,2                                                                                       1,2                                                    1,2                                 1,2                  Dana FIALOVA , David HYNEK , Pavel KOPEL , Vojtech ADAM , Rene KIZEK                 1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *kizek@sci.muni.cz                Abstract                 This  study  is  aimed  at  determining  the  effectiveness  of  reduced  graphene  oxide  and                 paramagnetic particles (Fe 2O 3) to adsorption of cadmium(II), lead(II), and copper(II) on its                surface. Different interaction time from 1 minute to 24 hours was tested. The main attention                 was paid to the detection of these metals using differential pulse voltammetry.                  1. INTRODUCTION                Metal ions are still a threat polluting environment and having great bioaccumulation potential                 [1, 2]. For isolation of heavy metals, it is possible to use different materials with high sorption                 properties that are able to adsorb metal ions onto their surface or into their structure. Different                modifications of carbon, such as graphene, nanotubes, or fullerenes are important members of                 this group [3]. Instead of various carbon modifications, paramagnetic particles (PMPs) with                 comparable properties can be also used [4].                  2. MATERIAL AND METHODS                 Chemicals                FeCl 3·6H 2O, FeCl 2.6·H 2O, and other chemicals were purchased from Sigma Aldrich (Sigma-                 Aldrich, USA) unless noted otherwise. Stock solutions were prepared with ACS water.                  Preparation of graphene and Fe 2O 3 MPs                    The reduced graphene oxide and paramagnetic particles (Fe 2O 3) were prepared according                to the [5-8].                  Electrochemical determination of metal ions                Determination of cadmium, lead, and copper by differential pulse voltammetry at HMDE was                 performed  using  a  797  VA  Stand  (Metrohm).  Acetate  buffer  (0.2  M  CH 3COONa  +                                                            160","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    CH 3COOH, pH 5) was used as a supporting electrolyte. The parameters of the measurement                 were as it follows: purging time 120 s, initial potential -1.3 V, end potential 0.2 V, deposition                potential -1.15 V, accumulation time 240 s, pulse amplitude 25 mV, pulse time 0.04 s, voltage                 step 5.035 mV, voltage step time 0.3 s, sweep rate 0.0168 V/s, volume of injected sample:                15 µl,  volume  of  measurement  cell  2  ml  (15  μl  of  sample;  1985  μl  acetate  buffer).                 Characteristic peak for cadmium was measured at potential of -0.62 V, for lead at potential of                -0.40 V, and for copper at potential of -0.03 V.                   3. RESULTS  AND  DISCUSSION                For determination of  the  concentration capacity,  10 mg of adsorbent  was applied. 1 ml  of                 solution of cadmium, lead, and copper in various concentrations was added to the adsorbent.                Concentration of metals was as it follows: 1, 50, 100, 200, and 500 µM. Time of interaction                 was 1 hour.                                                       Figure  1.:  Determination  of  the  concentration  of  adsorbent  capacity  of  graphene  (reduced  graphene  oxide):                concentration  capacity  (A)  for  cadmium,  (B)  for  lead,  and  (C)  for  copper  and  of  Fe 2 O 3   MPs:  concentration                capacity (D) for cadmium, (E) for lead, and (F) for copper. Efficiency of adsorption for each metal is plotted on                                                                    2+                                                               2+                                                           2+                the y-axis %. Applied concentrations of metals (Cd , Pb , Cu ) were 1 µM, 50 µM, 100 µM, 200 µM, and                500 µM.                                                               161","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  The  concentration  capacity  of  selected  adsorbents  was  determined  using  differential  pulse                 voltammetry. Based on the measured and evaluated data, the value of concentration, which is                the limit for both adsorbents (reduced grapheme oxide in Figs. 1A, B and C, Fe 2O 3 particles in                 Figs.  1D,  E  and  F)  was  determined.  The  limit  value  of  concentration  is  100  µM.  The                efficiency  of  adsorption  was  calculated  according  to  the  formula: Absorption  efficiency  =                 100 % - (C D / C V) * 100 (%). (C D is the detected concentration of metal in the filtrate. C V is                the bound concentration of metal). With application of increasing concentration of metal ions                 the efficacy of adsorption decreased. The reason for the reduced efficiency of adsorption with                 the increasing concentration of the metal is the formation of a monolayer on the surface of                adsorbent. The studied absorption effect is mainly caused by chemisorption [9, 10].                 This  fact  is  shown in  Fig. 1. The graphs  in  Fig. 1 show the specificity  of metals  for each                adsorbent.  Reduced  grapheme  oxide  preferably  binds  lead  ions  on  its  surface.  Ferrous                 magnetic particles bind all three metals to their surface with the same specificity.                  4. CONCLUSION                 Monitoring of adsorption properties of reduced graphene oxide and Fe 2O 3 particles related to                cadmium, lead and copper ions was investigated in this paper. From presented results seems                 that 100  M concentration of metal ions was limiting in the adsorption process of reduced                 graphene oxide and Fe 2O 3 particles.                  5. ACKNOWLEDGEMENT                Financial support from CEITEC CZ.1.05/1.1.00/02.0068 is greatly acknowledged.                   6. REFERENCES                [1] Adam V, Zehnalek J, Petrlova J, et al., Sensors, 5 (2005), 70-84.                [2] Fisher I J, Pain D J, Thomas V G, Biol. Conserv., 131 (2006), 421-432.                 [3] Sitko R, Zawisza B, Malicka E, TRAC-Trends Anal. Chem., 51 (2013), 33-43.                [4] Hsing I M, Xu Y, Zhao W T, Electroanalysis, 19 (2007), 755-768.                [5] Hummers W S, Offeman R E, J. Am. Chem. Soc., 80 (1958), 1339-1339.                [6] Chua K C, Pumera M, Chem. Soc. Rev., in press, 10.1039/C3CS60303B (2014).                [7] Magro M, Sinigaglia G, Nodari L, et al., Acta Biomater., 8 (2012), 2068-2076.                [8] Stankovich S, Dikin D A, Piner R D, et al., Carbon, 45 (2007), 1558-1565.                [9] Song J, Kong H, Jang J, J. Colloid Interface Sci., 359 (2011), 505-511.                [10] Mahdavi S, Jalali M, Afkhami A, J. Nanopart. Res., 14 (2012), 1-18.                                                                162","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      FIA-ED: OPTIMIZATION OF METHOD FOR ELECTROCHEMICAL                                             STUDY OF DOXORUBICIN                                                                1                                                                                                    1                                      1                      Roman GURAN , Marketa KOMINKOVA , Miguel Angel MERLOS RODRIGO ,                                                         1                                                                                                  1                                     1,2                                                                                   1                        Pavel KOPEL , Iva BLAZKOVA , Dagmar CHUDOBOVA , Lukas NEJDL ,                                                                             2                                          1                                                                                              1,2                           Zbynek HEGER , Branislav RUTTKAY-NEDECKY , Ondrej ZITKA ,                                                            1,2                                             Vojtech ADAM , Rene KIZEK      1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2   Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                   *kizek@sci.muni.cz                Abstract                 In the cancer treatment  the drug doxorubicin, among others, is widely used. This drug has                over its good cytostatic properties also cardiotoxic properties. For its negative properties there                 are  still  developed  a  new  application  possibilities  that  lead  to  reductions  in  dosage  of  this                substance.  Due  to  continuous  development  in  this  area  it  is  necessary  to  establish  low                 concentrations of doxorubicin in various matrices. In this work, we focused on improving the                 electrochemical  detection  of  doxorubicin  in  combination  with  flow  injection  analysis.  The                most suitable condition for the electrochemical detection of doxorubicin an alkaline pH was                 determined.                  1. INTRODUCTION                 Doxorubicin is a drug that is used to treat a variety of cancers, alone or in combination with                other  cytostatic  agents.  Currently  a  liposomal  doxorubicin  is  mainly  used,  as  liposomal                 packaging  reduces  significantly  the  cardiotoxicity  of  doxorubicin  itself.  Cardiotoxicity  of                doxorubicin is a limiting factor in the use of this cytostatic drug [1]. To test a negative impact                 of doxorubicin on organisms it is necessary to prove how to determine the concentration of                 this substance in the samples of tissues, cells and body fluids. These concentrations can be                very low and still can affect the organism. Therefore, it is necessary to develop new methods                 for detection of doxorubicin and reduce the cost of analysis. As one of the possible options                appears a flow injection analysis (FIA-ED).                                                                  163","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIAL AND METHODS                 Electrochemical determination                Flow injection analysis system consisted of a chromatographic pump Model 584 ESA (ESA                                                                              -1                Inc.,  Chelmsford,  MA)  (working  range  0.001-9.999  ml.min )  and  of  an  electrochemical                detector Coulochem (ESA, USA), to which the amperometric cell (model 5040, ESA, USA)                was connected. The cell contained a working electrode made from glassy carbon.                  3. RESULTS  AND  DISCUSSION                 To determine doxorubicin in body fluids, cells or tissues, we optimized buffer environment that will be suitable                for the detection of this substance by flow injection analysis (FIA-ED).                                                                                              -1                Figure 1.: Analysis of doxorubicin (50 mg.ml ) in different buffers by FIA-ED. The buffer, which was used for                dilution of doxorubicin aliquot, was used also as the mobile phase. The potential range was 100  -to 1200 mV                with 100 mV step. Blue marks in graphs represent maximal measured values. (A) Phosphate buffer (PB) with pH                5.5, 6.5 and 7.5. (B) Acetate buffer (AB) with pH 3.5, 4.5 and 5.5. (C) Borate buffer (BB) with pH 7.5, 8.5 and                9.5. (D) Britton-Robinson buffer (BR) with pH 2, 3, 4, 5, 6, 7, 8, 9 and 10. (E) The highest detector responses                 considering different buffers and applied potential.                                                                  164","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Each buffer was used in its natural buffering range: Britton-Robinson buffer (pH 2, 3, 4, 5, 6,                 7, 8, 9, 10), acetate buffer (pH 3.5, 4.5, 5.5), phosphate buffer (pH 5.5, 6.5, 7.5) and borate                buffer  (pH  7.5,  8.5,  9.5).  In  each  buffer  with  each  pH  the  hydrodynamic  voltammograms                 (HDVs)  were  measured  with  a  100  mV  step  within  the  range  from  100  to  1200  mV  for                phosphate buffer, acetate buffer, borate buffer and Britton-Robinson buffer (Figs. 1A, B, C,                 and D).                The largest peak area was achieved using the highest pH, which a Britton-Robinson buffer at                 pH  10.  With  decreasing  pH  the  peak  area  of  doxorubicin  measured  by  FIA-ED  was  also                 decreasing.  This  effect  of  pH  was  surprising  because  with  other  types  of  electrochemical                detection the low pH is preferably used [2-5] . For similar types of detection in HPLC the                 lower pH is used as well. Often a phosphate buffer with addition of triethylamine is used at                pH  lower  than  5  [5,6].  These  conditions  are  mainly  used  for  separation  but  the  signal  of                 detector  is  distinctly  lower  than  with  use  of  our  optimized  conditions  of  Britton-Robinson                buffer at pH 10 (Fig. 1E).                   4. CONCLUSION                Optimization  of  the  buffer  environment  suitable  for  electrochemical  detection  using  flow                 injection analysis (FIA-ED) was carried out in this work. Best detection was achieved using a                 Britton-Robinson buffer of pH 10. Decrease of pH lead to the reduction of the signal intensity.                These results suggest the possibility of improving the detection limits, when methods such as                 HPLC-ED are used, where buffers with substantially lower pH are commonly used.                  5. ACKNOWLEDGEMENT                The work has been supported by CEITEC CZ.1.05/1.1.00/02.0068.                 6. REFERENCES                 1.     Y. Z. Wang, Y. F. Ding, Z. M. Liu, X. R. Liu, L. Chen and W. L. Yan, Pharmaceutical Research, 30                       (2013) 2902.                2.     D. Hynek, L. Krejcova, O. Zitka, V. Adam, L. Trnkova, J. Sochor, M. Stiborova, T. Eckschlager, J.                       Hubalek and R. Kizek, International Journal of Electrochemical Science, 7 (2012) 13.                3.     Y. J. Guo, Y. H. Chen, Q. Zhao, S. M. Shuang and C. Dong, Electroanalysis, 23 (2011) 2400.                4.     D. Nieciecka and P. Krysinski, Langmuir, 27 (2011) 1100.                5.     Z. Jemelkova, J. Zima and J. Barek, Collection of Czechoslovak Chemical Communications, 74 (2009)                        1503.                6.     G.  Nicholls,  B.  J.  Clark  and  J.  E.  Brown,  Journal  of  Pharmaceutical  and  Biomedical  Analysis,  10                       (1992) 949.                                                              165","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                     FLOW  INJECTION  ANALYSIS  WITH  ELECTROCHEMICAL                 DETECTION  FOR  RAPID  IDENTIFICATION  OF  PLATINUM-BASED                 CYTOSTATICS AND PLATINUM CHLORIDES IN WATER                                                                  1                                               1                                                                                  1                        Marketa KOMINKOVA , Zbynek HEGER , Ondrej ZITKA , Rene KIZEK            1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                    3058/10, 616 00 Brno, Czech Republic                   *kizek@sci.muni.cz                 Abstract                During  the  cancer  treatment  high  concentration  of  platinum  cytostatics  from  the  urine  of                 patients ends up in wastewater. This leads to an increase in concentration of the platinum ions                 (PGEs) in  wastewater.  In order to  facilitate the detection of various types  of platinum, we                have developed a new, rapid screening flow injection analysis method with electrochemical                 detection  (FIA-ED).  The  developed  method  is  based  on  monitoring  changes  in  the                electrochemical behavior of analytes in Britton-Robinson buffers of pH 2 and 5. Changes are                 observed  in  a  comparison  of  the  response  of  amperometric  detector  using  a  glassy  carbon                electrode at an applied potential of 1000, 1100 and 1200 mV.                   1. INTRODUCTION                Due to the negative effects on organisms it is necessary to properly identify the presence of                 PGEs  and  especially  cytostatics  in  the  water  environment  which  serves  as  the  distribution                 route  [1].  The  most  widely  used  platinum-based  cytostatic,  cisplatin,  is  applied  in                                                 −2                concentrations  of  75–100  mg/m   of  body  surface  area,  oxaliplatin  in  concentrations  of                          −2                                                                             −2                150 mg/m   and  carboplatin  in  concentrations  of  400  mg/m .  Some  75%  of  the  applied                amounts  may  be  excreted  through  urine  into  wastewaters  [2].  These  values  indicate  the                 potential  seriousness  of  wastewater  contamination  with  platinum-based  cytostatics  and                highlight the importance of determination of their content.                   2. MATERIAL AND METHODS                 Electrochemical determination                The instrument for flow injection analysis with electrochemical detection (FIA-ED) consisted                 of  a  solvent  delivery  pump  (Model  582  ESA  Inc.,  Chelmsford,  MA,  USA)  and  an                                                             166","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    electrochemical detector. The electrochemical detector includes a flow-volume flow-through                 analytical cell (Model 5040, ESA), which consists of a glassy carbon electrode as a working                electrode, a hydrogen-palladium electrode as a reference electrode and an auxiliary electrode,                 and a Coulochem III unit as a control potentiostat module.                  3. RESULTS  AND  DISCUSSION                Analyte  detection  is  dependent  on  the  environment,  pH  and  on  the  applied  potential.  For                 oxaliplatin, cisplatin, carboplatin, PtCl 2 and PtCl 4 detection, Britton-Robinson buffers of pH                 2; 3; 3.5; 4; 5 and 6 were evaluated. Applied potential was chosen by earlier analyzes of 1000,                1100 and 1200 mV. To express the rates of change of electrochemical signal of platinum, peak                 heights after deduction of blank were rated.                                                  A  30              1000  1100  1200                                                  10                                                 -10                                                B  30                                                 10                                                  -10                                             (µA) C  30                                                 10                                             height  -10                                              Peak  D  30                                                 10                                                  -10                                               E  30                                                 10                                                  -10                                                       B-R 2  B-R 3  B-R 3.5  B-R 4  B-R 5  B-R 6                    Figure 1.: Expression of potentials (range 1000–1200 mV) in buffers Britton-Robinson buffer (B-R) with pH 2–                6 for each of PGEs obtained from HDVs. Ideal potentials for (A) oxaliplatin; (B) cisplatin; (C) carboplatin; (D)                PtCl 2 ;  (E)  PtCl 4   are  shown.  Optimal  potential  and  pH  buffer  for  determination  of  platinum-based  cytostatics                from platinum chlorides is highlighted with red color. Potential and pH buffer, characterizing concentration of                 platinum in sample is highlighted with orange.                                                                                                                                                        Figure 3                                                              167","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  As seen in Fig. 1, the most significant differences are in the detection in Britton-Robinson                 buffer of pH 2 and an applied potential of 1200 mV (Fig. 1, highlighted by a red borders),                contrast, when using a buffer pH 5 and the applied potential of 1200 mV (Fig. 1, highlighted                 by an orange border), minimal differences were reported in the detection of all tested PGEs                variants.  If  the  peak  height  of  platinum  measured  in  Britton-Robinson  of  pH  2  shows  an                 approximately 1.5–2.5 × higher value that in the same buffer with pH 5, the result points to                platinum  chlorides.  In  the  case  that  the  peak  height  of  platinum  analyzed  in  the  Britton-                 Robinson buffer of pH 2 is 5–9 × higher than in the same buffer of pH 5, platinum drugs are                 present in the water sample. Our method is based only on changing two buffers forming the                mobile phases of the FIA-ED system. This approach is rapid, cheap and it can be miniaturized                 and thus used for biosensor applications.                  4. CONCLUSION                 Based on the obtained results, we suggest a rapid and inexpensive method with the potential                 to  be  miniaturized.  The  FIA-ED  method,  based  on  the  comparison  of  the  responses  of  an                amperometric detector using a glassy carbon working electrode, can be used to distinguish the                 presence of platinum-based cytostatics from platinum chlorides.                  5. ACKNOWLEDGEMENT                The work has been supported by CEITEC CZ.1.05/1.1.00/02.0068.                   6. REFERENCES                [1] Supalkova V, Beklova M, Baloun J, et al., Bioelectrochemistry, 72 (2008), 59-65.                [2] Lenz K, Hann S, Koellensperger G, et al., Sci. Total Environ., 345 (2005), 141-152.                                                                             168","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                               ELECTROPHORETIC BEHAVIOR OF DOXORUBICIN                                                            1                                     1                                                                                      1                                                                                                         1                 Romana KONECNA , Hoai Viet NGUYEN , Maja STANISAVLJEVIC , Iva BLAZKOVA ,                                                                                               3                                                                         2                                            2                           Sona KRIZKOVA , Marketa VACULOVICOVA , Marie STIBOROVA ,                                                                                  1,2                                                                1,2                                               4                                                                                                  1,2                       Tomas ECKSCHLAGER , Ondrej ZITKA , Vojtech ADAM , Rene KIZEK                1                 Department  of  Chemistry  and  Biochemistry,  Faculty  of  Agronomy,  Mendel  University  in                Brno, Zemedelska 1, CZ-613 00 Brno, Czech Republic, European Union                2 Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                3058/10, CZ-616 00 Brno, Czech Republic, European Union                3                 Department of Biochemistry, Faculty of Science, Charles University, Albertov 2030, CZ-128                40 Prague 2, Czech Republic, European Union                4 Department  of  Paediatric  Haematology  and  Oncology,  2   Faculty  of  Medicine,  Charles                                                                           nd                University, and University Hospital Motol, V Uvalu 84, CZ-150 06 Prague 5, Czech Republic,                European Union                    *kizek@sci.muni.cz                  Abstract                 Doxorubicin  (DOX)  belongs  to  the  group  of  anthracycline  antibiotics  with  very  effective                anticancer  properties.  In  this  work,  the  DOX  behavior  in  capillary  electrophoresis  was                 investigated. Electrophoretic mobilities in of the background electrolyte (pH range from 3 to                                                                           -2                                                                        -9                                                                                -1                                                                                   -1                11) were determined in the range from 16.3 to -13.3 × 10   m . V . s .                 1. INTRODUCTION                Generally, anthracyclines belong to the most effective anticancer drugs, and DOX is highly                 efficient and widely used. This compound was firstly isolated from Streptomyces peucetius in                                                                                                 2                1960s  [1].  The  administration  of  the  drug  over  the  cumulative  dose  550  mg/m   of  body                surface  area  leads  to  severe  side  effects  including  high  risk  of  cardiomyopathy  [2,  3].                 Nevertheless, cardiac failures can be identified at smaller doses too. This cardiotoxicity is the                main  force  driving  the  progress  towards  less  toxic  formulations,  enabling  also  targeted                 delivery of the drug [4-10]. Due to the optical properties of DOX as well as its biological                activity, this molecule is still a target of numerous investigations [11-13].                                                                    169","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. MATERIAL AND METHODS                 Capillary electrophoresis with laser induced fluorescenc detection (CE-LIF)                DOX  was  analyzed  by  CE-LIF  (PACE  MDQ,  Beckman  Coulter,  USA).  A  fused  silica                 capillary with internal diameter of 75 µm and with the total length 64.5 cm (54 cm to detector                window) was used. The separation voltage of 20 kV and hydrodynamic injection by 3 psi for                 10 s was employed.                  3. RESULTS  AND  DISCUSSION                 The behavior of the analyte in various environments is one of the key aspects that have to be                considered prior to analysis by capillary electrophoresis. Analysis by separation methods such                 as capillary electrophoresis with laser-induced fluorescence detection may provide valuable                information on the presence of various components, contaminations or even analyte species in                 the studied solution. Due to the complex structure of DOX and due to the presence of several                functional  groups,  DOX  may  occur  as  a  cation,  anion,  zwitterion  and/or  neutral  molecule                 depending on the environment.                 To determine the ionic form of DOX and its pI, phosphate buffer with pH 3, 4, 6, 8, 10, or 11                was used as a separation electrolyte and coumarine 334 was employed as an EOF marker. The                 obtained electropherograms are shown in Fig. 1. pH as low as 3 caused very slow EOF and                 therefore only DOX peak was obtained, however, the increasing pH above this value, peaks of                both  DOX  and  coumarine  334  were  detected.  DOX  migrated  as  a  cation  (before  the  EOF                 marker) in the pH up to 10. When the pH was increased to 11, the peak of DOX occurred after                the EOF marker, which confirmed the anionic form of DOX. As expected, based on previous                 fluorimetric experiments, the peak height of DOX decreased with the increasing pH. From the                migration  times,  the  electrophoretic  mobilities  were  calculated.  It  clearly  follows  from  the                                                                                                      -9                results obtained that the electrophoretic mobilities change over the range from  16.3×10  to -                            2                               -1 -1                        -9                13.2×10  m .V .s .                                                                               170","b                     a                                                                                            20                                                                                            15                                                                                                        R² = 0.9981                                                                                           Peak height                                                                                            10                                                                                             5                                                                                             0        y = 6.9652x - 0.31       XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                               0  Brno 2014  1           1.5       2                                                                                                        0.5                                                                                                   DOX  concentration (µg/mL)                                                                                                                   (µg/mL)                     c                                                                     d                                                      15                      14.8 15                        14.8                                                           20                            pH 3                           pH 4                                                     15                                                                     DOX                      1                    . s -1 )                                                      9.8                      (a.u.)  9.8 10      DOX        (a.u.)  10                                                    . V -1  10                      I F  4.8 5                     I F  4.8 5                             Peak height  (a.u.)      5 0                      -0.2 0                         -0.2 0              EOF                 0.5                   (10 -9 . m -2  -5  2  4  6  8 10 12                          0   2  4  6   8 10 12 14        0  2  4   6  8 10 12 14                                  -10       pH                              Migration time (min)             Migration time (min)                                EP                       15                     14.8                           14.8 15  pH 8                                                  µ  -15                            pH 6                                                              0                    -20                      (a.u.)  9.8                    (a.u.)  9.8 10                              pH 4 pH 6 pH 8                       10                      I F  4.8 5  EOF                I F  4.8 5                             DOX                            DOX  EOF                      e                      -0.2 0                         -0.20                                                          20                          0   2  4   6  8 10 12 14       0   2  4   6  8  10 12 14          (a.u.)                  15                                 Migration time (min)          Migration time (min)           1                    . s -1 )  10                       45                      15   pH 10                    14.8   pH 11                            Peak height            . V -1  5                                                      15                       30                      (a.u.)  10     DOX   EOF       (a.u.)  9.8     EOF  DOX                0.5                   m -2  EP  (10  -9  -5 0  2  4  6  8  10 12                                                      10                      I F  15 5                      I F  4.8 5                                                     -10      pH                                                                                                                   µ  -15                        0 0                          -0.2 0                                   0                     -20                          0   2  4   6  8  10 12 14      0   2  4   6  8  10 12 14               pH 4 pH 6 pH 8                               Migration time (min)           Migration time (min)                 Figure 1.: CE-LIF of DOX with pH matching to BGE pH, DOX concentration 0.5 μg/mL,                 CE conditions: capillary 75 μm, 64.5/54 cm; voltage +20 kV; injection 3 psi, 10 s; BGE 10                 mM sodium phosphate pH 3, 4, 6, 8, 10 or 11. (c) Left - DOX peak heights obtained when                BGE pH matched sample zone pH (BGE 10 mM phosphate buffer pH 4, 6 and 8), right  -                 electrophoretic mobilities of DOX under conditions matching the pH of BGE and DOX zone.                  4. CONCLUSION                The  fluorescence  properties  of  DOX  are  strongly  dependent  on  the  environment  and  the                 increasing pH as well as the presence of water causes the fluorescence quenching. Using CE,                 the electrophoretic mobility of DOX as well as the pI was calculated.                  5. ACKNOWLEDGEMENT                The financial support from GA CR CYTORES P301/10/0356 is highly acknowledged.                                                                   171","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  6. REFERENCES                 [1] Weiss R B, Semin. Oncol., 19 (1992), 670-686.                [2] Zagotto G, Gatto B, Moro S, et al., Journal of Chromatography B, 764 (2001), 161-171.                [3] Singal P K, Iliskovic N, New England Journal of Medicine, 339 (1998), 900-905.                [4] Zhen Z P, Tang W, Guo C L, et al., ACS Nano, 7 (2013), 6988-6996.                [5] Meng L J, Zhang X K, Lu Q H, et al., Biomaterials, 33 (2012), 1689-1698.                [6] Tacar O, Sriamornsak P, Dass C R, Journal of Pharmacy and Pharmacology, 65 (2013), 157-170.                [7] Wang Y G, Wei X L, Zhang C L, et al., Therapeutic Delivery, 1 (2010), 273-287.                [8] Blazkova I, Nguyen H V, Dostalova S, et al., Int. J. Mol. Sci., 14 (2013), 13391-13402.                 [9] Drbohlavova J, Chomoucka J, Adam V, et al., Curr. Drug Metab., 14 (2013), 547-564.                [10] Tmejova K, Hynek D, Kopel P, et al., Int. J. Electrochem. Sci., 8 (2013), 12658-12671.                [11] Baran T M, Foster T H, Lasers Surg. Med., 45 (2013), 542-550.                [12] Li D A, Zhang Y T, Yu M, et al., Biomaterials, 34 (2013), 7913-7922.                [13] Schenone A V, Culzoni M J, Campiglia A D, et al., Anal. Bioanal. Chem., 405 (2013), 8515-8523.                                                                                                172","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                        UTILIZATION OF ELECTROCHEMISTRY FOR DETECTION OF                                  BACTERIA ON A 3D PRINTED FLOW CHIP                                      1                                                 1                                                                         1                                                                                                  1                       Lukas NEJDL , Jiri KUDR , Kristyna CIHALOVA , Dagmar CHUDOBOVA ,                                                                             2                                                                                                  2                                                         2                                        1                         Michal ZUREK , Ludek ZALUD , Lukas KOPECNY , Frantisek BURIAN ,                                                        1,2                                                                             1,2                                                                                                  1,2                      Branislav RUTTKAY–NEDECKY , Sona KRIZKOVA , Marie KONECNA ,                                                                   2                                                                                     1,2                                  1,2                                                   1,2                   David HYNEK , Pavel KOPEL , Jan PRASEK , Vojtech ADAM , Rene KIZEK                1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *kizek@sci.muni.cz                Abstract                The  electrochemical  method  of  differential  pulse  voltammetry  was  used  for  detection  of                electrochemically active 1-naphthol as the result of enzymatic cleaving of electrochemically                 inactive 1-naphthyl phosphate. 3D printed flow chip performed detection of Staphylococcus                aureus based on alkaline phosphatase activity. Bacteria from the solution were captured by                 application of modified magnetic particles in the chip. The detection limit of electrochemical                 determination of 1-naphthol was 20 nM.                1. INTRODUCTION                 Alkaline  phosphatase  (ALP)  is  produced  during  the  growth  and  sporulation  of  various                 bacterial strains (Staphylococcus aureus [1], Bacillus cereus and Bacillus amyloliquefacians                [2-4], Escherichia coli [5], thermophilic bacteria [6] like Thermotoga neapolitana, Thermus                 caldophilus,  Thermus  thermophiles,  Bacillus  stearothermophilus,  Pyrococcus  abyssi  and                Deinococcus  radiodurans  [7-9]).  For  detection  of  an  enzyme  activity,  electrochemical                 detectors (ECD) can provide competitive advantages with respect to other detection systems                such as portability, low cost, and low power requirements [10-12].                 2. MATERIAL AND METHODS                 Fabrication of 3D microfluidic chip                The microfluidic chip was 3D processed in Blender 2.65 (Blender foundation, Amsterdam,                 Netherlands)  and  further  edited  in  NetFabb  (Netfabb,  Parsberg,  Germany).  Acrylonitrile                butadiene  styrene  was  used  as  a  material  (DO-IT,  Straznice,  Czech  Republic),  and  every                 printed chip was fitted with five input tubes with a diameter of 0.5 mm, one output tube with                diameter 0.5 mm, two electromagnet and thermostatic system.                                                               173","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Screen printed electrode (SPE) design and fabrication                 Electrode system was designed and fabricated as a disposable planar three-electrode sensor in                LabSensNano laboratories (Brno University of Technology, Czech Republic). The properties                 of design and optimization can be found in the following papers.                Microfluidic analysis with differential pulse voltammetric detection                 The flow cell for SPE was designed in the shape of a cuboid with sides of 1 cm (width) ×                1.5 cm (height) × 3 cm (length). The reaction zone was dimensioned for 20 µl of analyte with                 0.7  mm  wide  inlet  and  outlet  channel.  The  sample  was  injected  using  a  peristaltic  pump                 (Amersham Biosciences, Uppsala, Sweden). After optimization of the automated flow system                additionally a peristaltic pump Minipuls®3 (Gilson, Middleton, USA) and a stirred water bath                 WB-4MS (Biosan, Riga, Latvia) were used. Changes of reduction signals were measured with                a potentiostat PGSTAT 101 (Metrohm, Herisau, Switzerland) and the results were evaluated                 by the Software NOVA 1.8 (Metrohm, Herisau, Switzerland). Settings of the potentiostat were                as it follows: initial potential -0.2 V, end potential +0.5 V, step potential 0.005 V, modulation                 amplitude  0.1  V,  modulation  time  0.004  s,  interval  time  0.1  s,  deposition  time    60  s  and                 equilibration  time  5  s.  For ALP  detection  50  mM  carbonate  buffer  (32  mM  Na 2CO 3  and                68 mM NaHCO 3) pH 9.9 with 1 mM 1-naphthyl phosphate was used [13, 14].                 3. RESULTS  AND  DISCUSSION                 For  electrochemical  determination  of  1-naphthol  by  DPV  the  optimal  conditions                (measurement temperature, flow rate or accumulation time) were measured. The calibration                                                                2                curve of 1-naphthol with regression coefficient R =0.999 was measured (Fig. 1) and the limit                of detection and quantification was calculated (Table 1).                                         Figure  1.:  Calibration  curve  of  1-naphthol  obtained  by  DPV  under  the  optimized  conditions  (measurement                                                -1                temperature 35 °C, flow rate 500 µl.min , accumulation time 60 s)                                                             174","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Table 1. Analytical parameters of electrochemical determination of 1-naphthol.                                                                                        **                                                                             2*                 Substance  Regression equation  Linear dynamic range      R      LOD   LOQ    ***   RSD ****                                                           (µM)                    (nM)    (nM)      (%)                 1-naphthol  y = 0.1643x + 0.0103       0.079 - 6.25      0.999     20       79      6.5                 *      …regression coefficients                **     …limits of detection of detector (S/N = 3)                ***    …limits of quantification of detector ( S/N = 10)                ****   …relative standard deviations                 4. CONCLUSION                A flow chip was used for electrochemical detection of bacteria by electrochemically active 1-                 naphthol. The chip could be the part of robotic system and it can serve for remote control of                bacteria presence [15].                 5. ACKNOWLEDGEMENT                 Financial support from the project CEITEC CZ.1.05/1.1.00/02.0068 is highly acknowledged.                The authors wish to express their thanks also to Jan Zitka, Lukas Zima, Martina Stankova,                 Lukas Melichar and Radek Chmela for perfect technical assistance.                6. REFERENCES                 [1]Krizkova S, Jilkova E, Krejcova L, et al., Electrophoresis, 34 (2013), 224-234.                [2]Panosian T D, Nannemann D P, Watkins G R, et al., Journal of Biological Chemistry, 286 (2011), 8043-8054.                [3]Iverson T M, Panosian T D, Birmingham W R, et al., Biochemistry, 51 (2012), 1964-1975.                [4]Ramesh A, Sharma S K, Joshi O P, et al., Indian Journal of Microbiology, 51 (2011), 94-99.                 [5]Koksharov M, Lv C Q, Zhai X H, et al., Protein Expression and Purification, 90 (2013), 186-194.                [6]Takano Y, Edazawa Y, Kobayashi K, et al., Earth and Planetary Science Letters, 229 (2005), 193-203.                [7]Nitzan Y, Ashkenazi H, Photochemistry and Photobiology, 69 (1999), 505-510.                [8]Brim H, McFarlan S C, Fredrickson J K, et al., Nature Biotechnology, 18 (2000), 85-90.                [9]Sghaier H, Bouchami O, Desler C, et al., Annals of Microbiology, 62 (2012), 493-500.                [10]Wang J, Electroanalysis, 17 (2005), 1133-1140.                 [11]Vandaveer W R, Pasas-Farmer S A, Fischer D J, et al., Electrophoresis, 25 (2004), 3528-3549.                [12]Nugen  S  R,  Asiello P J, Baeumner  A J, Microsystem Technologies-Micro-and Nanosystems-Information                Storage and Processing Systems, 15 (2009), 477-483.                [13]Zitka O, Krizkova S, Krejcova L, et al., Electrophoresis, 32 (2011), 3207-3220.                [14]Nejdl L, Merlos Rodrigo M A, Kudr J, et al., Electrophoresis, 35 (2014), 393-404.                [15]Nejdl L, Kudr J, Cihalova K, et al., Electrophoresis,  (2014).                                                                   175","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                     LIPOSOMAL TRANSPORTER WITH GFP MARK FOR TARGETED BINDING                                      USING A NUCLEIC ACID ANCHOR SYSTEM                                   1                                                                                                    2                                                      1                                                                   1                     Lukas NEJDL , Iva BLAZKOVA ,  Jiri KUDR , Branislav RUTKAY-NEDECKY ,                                                                             1,2                                          2                                                           1,2                             Pavel KOPEL , Ondrej ZITKA , Vojtech ADAM  , Rene KIZEK         2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *kizek@sci.muni.cz                Abstract                 In  our  work,  we  focused  on  the  possibility  of  modification  of  liposomes  with  gold                nanoparticles  (AuNPs).  In  addition,  AuNPs-modified  liposomes  were  labelled  by  green                 fluorescent protein (GFP). Modified liposomes were isolated using magnetic microparticles                (oligo(DT) 25)-nucleic  acid  anchor  system  (ODN-  5´TCTGCATTCCAGAAAAA).  Isolation                 efficiency  of  lipoGFP-AuNPs  was  20  %.  Gel  electrophoresis,  MALDI-TOF,  UV/VIS                 spectrophotometry and fluorescence imaging were used to characterize individual parts of the                system lipoGFP-AuNPs.                   1. INTRODUCTION                Liposomes are artificially-prepared microscopic particles formed by an (phospho)lipid bilayer                 that encloses an aqueous compartment. Their size varies in the range from 0.1 – 1 µm. Due to                the inner aqueous compartment, they are able to carry various types of compounds (drugs,                 proteins,  nucleic  acids,  and  metal  ions)  [1-4].  Hydrophobic  molecules  can  be  loaded  into                bilayer and hydrophilic to the cavity, where are protected against degradation processes [5, 6].                 In addition, changes in the lipid composition, surface charge, and the method of preparation                 significantly affect their properties [7]. Due to this fact, liposomes have found an application                in the medicine and pharmacy, for the delivery of new biotechnology products, for example                 antisense oligonucleotides, cloned genes, and recombinant proteins.  It has been established                that  numerous  anti-cancer  agents  are  non-toxic  in  the  liposomal  form  in  comparison  with                 conventional free drugs [8-10].                                                                   176","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    2. MATERIAL AND METHODS                  Chemicals                Cholesterol,  1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol)  sodium  salt,  chloroform,                 Zn(NO 3) 2.6H 2O,  sodium  citrate,  HAuCl 4·3H 2O  and  water  were  purchased  from  Sigma-                Aldrich  (St.  Louis,  MO,  USA)  in  ACS  purity,  unless  noted  otherwise.  Hydrogenated                 phosphatidylcholine from soybean was a gift from Lipoid GMBH (Ludwigshafen, Germany).                Magnetic particles (MPs) oligo(DT) 25 were purchased from Invitrogen (Oslo, Norway). To                 pipette volumes down to microlitres, pipettes used were purchased from Eppendorf Research                 (Hamburg, Germany) with the highest certified deviation (±12 %). The deionised water was                prepared using reverse osmosis equipment Aqual 25 (Aqual, Brno, Czech Republic).                 Fluorescence measurement                Fluorescence spectra were acquired by a multifunctional microplate reader Tecan Infinite 200                 PRO (TECAN, Switzerland). Wavelength 400 nm was used as an excitation wavelength and                the fluorescence scan was measured within the range from 440 to 800 nm per 5-nm steps. The                 detector gain  was set to 100. To each well was placed 50 μl of sample. All measurements                 were performed at 30 °C controlled by the Tecan Infinite 200 PRO (TECAN, Switzerland).                  3. RESULTS  AND  DISCUSSION                 The whole system consisted of GFP encapsulated in liposome (LipoGFP) whose surface was                modified by gold nanoparticles (Fig. 1 a). Due to high affinity of gold to thiol groups (-SH),                 oligonucleotide  (ODN-SH)  that  was  linked  complementary  with  the  second  part  of  ODN,                which  contained  adenine  moieties  (AAAAA),  see  Fig.  1  b.  The  liposomal  transporter                 (LipoGFP-AuNPs) was  anchored to magnetic microparticles (MBs)oligo(DT) 25 via adenine                moieties, see Fig. 1 c. The functionality of individual connections (AuNPs-ODN-SH-ODN-                 AAAA-(MBs)oligo(DT) 25) was tested electrochemically (differential pulse voltammetry).                             Figure 1: Schematic representation of nanoconstruct consisting of (a) a liposome with encapsulated GFP and                nano gold (AuNP) attached to the liposome surface (b) the anchoring system comprising two oligonukleotides                and (c) magnetic particle.                                                             177","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  4. CONCLUSION                 Amplified GFP was isolated and further characterized by gel electrophoresis, MALDI-TOF,                and fluorescence imaging. Subsequently, GFP was enclosed in nanogold-modified liposomes                 that  were  isolated  using  magnetic  microparticles  and  nucleic  acid  anchor  system.                Effectiveness  of  the  whole  isolation  process  was  20%.  The  functionality  of  the  whole                 procedure was verified using fluorimetry.                  5. ACKNOWLEDGEMENT                 Financial support from the project CYTORES GA CR P301/10/0356 is highly acknowledged                  6.REFERENCES                [1] Schafer J, Hobel S, Bakowsky U, et al., Biomaterials, 31 (2010), 6892-6900.                 [2] Chen X, Wang X, Wang Y, et al., Journal of Controlled Release, 145 (2010), 17-25.                [3] Villares G J, Zigler M, Wang H, et al., Cancer Research, 68 (2008), 9078-9086.                [4] Martins S, Sarmento B, Ferreira D C, et al., International Journal of Nanomedicine, 2 (2007), 595-607.                [5] Milla P, Dosio F, Cattel L, Current Drug Metabolism, 13 (2012), 105-119.                [6] Bochot A, Fattal E, Journal of Controlled Release, 161 (2012), 628-634.                [7] Akbarzadeh A, Rezaei-Sadabady R, Davaran S, et al., Nanoscale Research Letters, 8 (2013).                [8] Ding Z-Y, Zhou L, Liu Y-M, et al., Thoracic Cancer, 4 (2013), 14-19.                 [9] Xu X, Wang L, Xu H-Q, et al., Asian Pacific Journal of Cancer Prevention, 14 (2013), 2591-2594.                [10] Zhao C, Feng Q, Dou Z, et al., PloS one, 8 (2013), e73860-e73860.                                                                                   178","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                       INTERACTION STUDY OF ARSENIC(III) IONS WITH METALLOTHIONEIN                          GENE (MT2A) FRAGMENT ASSESSED BY SPECTROMETRY AND                                                ELECTROCHEMISTRY                               1                                                       1                                                                    1                                                                                                       1,2                 Lukas NEJDL , Sylvie SKALICKOVA , Jiri KUDR , Branislav RUTTKAY-NEDECKY  ,                                                               1                                                                                   1                                       2                                                                                                    1,2                 Simona DOSTALOVA , Monika KREMPLOVA , Marie KONECNA , Vojtech ADAM  and                                                      Rene KIZEK  1,2*                1   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *kizek@sci.muni.cz                 Abstract                Interactions  between As(III)  and metallothionein  gene Mt2A were monitored using UV/vis                 spectrophotometry,  atomic  absorption  spectrometry,  electrochemical  measurements  and                agarose  gel  electrophoresis.  By  application  of  the  mentioned  methods  it  was  observed  the                 As(III) forms the stable structure with DNA in the concentration range of As(III) 0.4 – 6.25                µg/ml. The higher concentration of As(III) caused the DNA degradation.                   1. INTRODUCTION                Arsenic is classified as a worldwide pollutant and human carcinogen. Oxidative stress due to                 arsenic  exposure  is  proposed  as  one  potential  mode  of  carcinogenic  action  [1].  There  are                currently  over  100  active  clinical  trials  involving  inorganic  arsenic  or  organoarsenic                 compounds registered with the Food and Drug Administration for the treatment of cancers [2].                Arsenic  trioxide  is  presently  the  most  active  single  agent  in  the  treatment  of  acute                 promyelocytic leukemia (APL) [3, 4].                  2. MATERIAL AND METHODS                 Chemicals                 Standards of As(III) – Arsenic chloride (AsCl 3) was purchased from Sigma-Aldrich (St. Louis,                MO, USA) in ACS purity. Standards were dissolved in ACS water                 DNA fragment amplification and isolation                Human genomic DNA was isolated from blood via MagNA Pure Compact (Roche, Germany)                 using Nucleic Acid Isolation Kit I and protocol DNA_Blood_100_400.                                                              179","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Electrochemical Measurements of As - DNA                  Determination of DNA was performed with 797 VA Stand instrument connected to 889 IC                Sample  Center  (Metrohm,  Switzerland).  The  analyser  (797  VA  Computrace,  Metrohm,                 Switzerland) employs a conventional three-electrode configuration with a hanging mercury                                                                         2                drop  electrode  (HMDE)  with  a  drop  area  of  0.4  mm   was  the  working  electrode.  An                Ag/AgCl/3M KCl electrode was the reference and glassy carbon electrode was auxiliary.                  3. RESULTS  AND  DISCUSSION                 The As-DNA interaction was proved using square wave voltammetry (SWV).  First reports                about electrochemical reduction and oxidation signal of nucleic acids were published at the                 end of 1950s and in the beginning of 1960s [5]. It was pointed out that these signals are due to                residues of bases in DNA. Adenine and cytosine in DNA yielded reduction signals (CA peak)                 [6].  As-DNA  was  demonstrated  due  to  the  significant  change  of  CA  peak  with  increasing                concentrations of As(III) from control DNA, Fig. 1. Using this method, it was proven that the                 studied concentration of As(III) plaied an important role (RSD 6%) in the DNA damage.                                             Figure  1.:  Voltamograms  (a)  of  5  µg/ml  DNA  and  5  µg/ml  DNA  with  As  (III)  in                 concentrations (b) 50, (c) 100 and (d) 200 µg/ml.                  4. CONCLUSION                 In  this  study,  it  was  proven  that  the  As(III)  caused  damage  of  the  secondary  structure  of                DNA. These properties of As(III) play an important role in the apoptosis induction by APL.                                                                180","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    5. ACKNOWLEDGEMENT                 Financial  support  from  the  project  NANOLABSYS  CZ.1.07/2.3.00/20.0148  is  highly                acknowledged                  6. REFERENCES                 [1]       Ding W, Hudson LG, Liu KJ (2005) Mol. Cell. Biochem. 279.                [2]       Swindell EP, Hankins PL, Chen HM, Miodragovic DU, O'Halloran TV (2013) Inorg. Chem. 52.                [3]       Yang H, Lin S, Cui JR (2014) Gene 535.                [4]       Yujiri T, Tanaka M, Taguchi A, Tanaka Y, Nakamura Y, Tanizawa Y (2014) Ann. Hematol. 93.                [5]       Palecek E (2002) Talanta 56:809-819.                 [6]       Krejcova L, Huska D, Hynek D, Kopel P, Adam V, Hubalek J, Trnkova L, Kizek R (2013) Int. J.                Electrochem. Sci. 8:689-702.                                                                                             181","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                    AUTOMATIC ELECTROCHEMICAL DETERMINATION OF HEAVY                       METALS AND APPLICATION TO A REMOTE-CONTROLLED                                    ROBOTIC PLATFORM ORPHEUS-HOPE                                       1,2                                                      1                                                                     1                                                                                      1,2                  Hoai Viet NGUYEN , Lukas ZIMA , Lukas NEJDL , David HYNEK , Rene KIZEK              1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *kizek@sci.muni.cz                 Abstract                Heavy metals are natural components of Earth’s crust. They can be found in many places such                 as soil, water, and air. High concentration of heavy metals can affect negatively human health                and environment. The main aim of this study is to determine heavy metals ions such as zinc,                 cadmium, lead, and copper by automatic electrochemical analysis. We chose a carbon tip as a                working  electrode.  Furthermore,  this  system  was  applied  into  a  remote-controlled  robotic                 platform ORPHEUS-HOPE.                  1. INTRODUCTION                 Heavy  metals  pollution  is  a  major  health  problem,  representing  a  danger  for  worldwide                citizens. \"Heavy metal\" term describes metallic species that typically include the transition                 metals, some metalloids, lanthanides, and actinides. Although many metals are essential for                cell metabolism and function, excess amounts can be toxic. Some metals can bio-accumulate                 in  the  food  chain  and  are  regarded  as  serious  environmental  pollutants,  because  of  their                 toxicity to higher species [1]. In order to prevent the accumulation of these toxic chemical                species,  it  is  needed  for  a  portable,  low  cost  monitoring  of  heavy  metals  concentrations.                 Electrochemical detection is the very sensitive analytical methods available for determination                 of heavy metals ions [2]. In this study, automatic electrochemical detection was employed for                determination of zinc, cadmium, lead, and copper. Moreover, this system was applied into the                 remote-controlled robotic platform ORPHEUS-HOPE. ORPHEUS-HOPE is a rugged robotic                system  which  easily  equipped  with  additional  devices,  such  as  radiation  and  biological                 sensors. Robot can work well during night or in bad visibility conditions, since it has sensitive                full  user  control.  In  addition,  Robot  performs  well  in  mud  and  snow,  but  it  is  also  fully                                                                 182","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    capable  of  indoor  operation.  Even  the  control  of  the  robot  is  ready  for  narrow  spaces                 operation [3].                  2. MATERIAL AND METHODS                 Automatic electrochemical detection was performed by an electrochemical robotic using three                electrodes. The commercial carbon tip was used as a working electrode. Ag/AgCl/3M KCl                 was  reference electrode  (Metrohm, Swizerland) and counter electrode was  injection needle                (Metrohm). Electrochemical signal was recorded with a potentiostat PGSTAT 101 (Metrohm,                 Herisau,  Switzerland)  and  software  NOVA  1.8  (Metrohm,  Herisau,  Switzerland)  was                employed  for  data  evaluation.  The  electrochemical  robotic  has  two  parts.  The  first  part                 connected with a new holder which is printed by PROFI 3D MARKER printing system. Three                 electrodes  were  put  on this holder. This  holder  can easily move up  and down through the                vertical axis. The second part of the system connected with plate containing sample. This part                 can move left and right through the horizontal axis. ElChemRo software was employed for                 automatic moving of the system.  The differential  pulse voltammetry parameters were  as it                follows:  initial  potential  -1.6  V,  end  potential  0.2  V,  step  potential  0.005,  modulation                 amplitude 0.1 V, modulation time 0.004 s, interval time 0.1 s. All experiments were carried                out at room temperature. Acetate buffer (0.2 M CH 3COOH and 0.2 M CH 3COONa) was used                 as the supporting electrolyte.                  3. RESULTS  AND  DISCUSSION                 a.     Determination of each heavy metal by automatic electrochemical detection                The  commercial  carbon  tip  electrode  was  used  as  working  electrode  for  detection  of                 cadmium,  lead,  and  copper  ions.  By  applying  a  conditioning  time  of  60  s  at  -0.9  V  into                 Hg(NO 3) 2 solution, thin-film mercury was created. This carbon tip electrode modified with                mercury film was employed for detection of zinc ion. Firstly, effect of accumulation time was                 tested and then 120 s of accumulation time was chosen for finding calibration curve as well as                 limit of detection of these heavy metals, which is shown in Fig. 1. Copper and zinc produced                lowest limit of detection (200 nA).                 b.     Determination of mixture of heavy metals by automatic electrochemical detection                 Mixture of 4 heavy metals was monitored using carbon tip electrode modified by mercury                 film. Firstly, 10 µg/ml of each heavy metal was used for the mixture. There is a difference                between signals of each heavy metal in the mixture in comparison with single heavy metal.                                                              183","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  Therefore, different concentrations (10, 5, 2.5, and 1.25 µg/ml) of each heavy metals in the                 mixture were tested.                                             Figure.  1.:  Calibration  curve  of  cadmium,  lead,  copper,  and  zinc  ions.  The  parameters  were  as  it  follows:                accumulation  time  of  120  s,  initial  potential  -1.6  V,  end  potential  0.2  V,  step  potential  0.005,  modulation                amplitude 0.1 V, modulation time  0.004 s, interval time 0.1 s.                  4. CONCLUSION                Electrochemcial  monitoring  of  heavy  metals  by  the  commercial  carbon  tip  electrode  was                 presented in this study. Based on the result, it can be concluded that copper and zinc produced                lower limit of detection in comparison with lead and cadmium.                   5. ACKNOWLEDGEMENT                The work has been supported by CEITEC CZ. 1.05/1.1.00/02.0068.                  6. REFERENCES                 [1] Musameh M M, Hickey M, Kyratzis I L, Research on Chemical Intermediates, 37 (2011), 675-689.                [2] Krystofova O, Trnkova L, Adam V, et al., Sensors, 10 (2010), 5308-5328.                [3] Nejdl L, Kudr J, Cihalova K, et al., Electrophoresis,  (2014), 1-13.                                                                      184","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      MICRORNA ELECTROCHEMICAL DETECTION IN CONNECTION                                  WITH SPECIFIC MAGNETIC SEPARATION                                                                                               1                                                                        2                                                 1                           Kristyna SMERKOVA , Kristyna HUDCOVA , Veronika VLAHOVA ,                                            1,3                                                                                       2                                                                                                        1,3                                                                   4                Marketa VACULOVICOVA , Vladimir PEKARIK , Michal MASARIK , Vojtech ADAM ,                                                      Rene KIZEK  1,3*                1                 Department  of  Chemistry  and  Biochemistry,  Faculty  of  Agronomy,  Mendel  University  in                Brno, Zemedelska 1, CZ-613 00 Brno, Czech Republic, European Union                2 Department of Pathological Physiology, Faculty of Medicine, Masaryk University, Kamenice                 5, CZ-625 00 Brno, Czech Republic, European Union                3                 Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                3058/10, CZ-616 00 Brno, Czech Republic, European Union                4 Department  of  Cellular  and  Molecular  Neurobiology,  Central  European  Technology                 Institute, Masaryk University, Kamenice 735/3, CZ-625 00 Brno, Czech Republic, European                 Union                   *kizek@sci.muni.cz                 Abstract                 The microRNAs (miRNAs) belong to small non-protein-coding RNAs. These miRNAs have                different  expressions  at  different  diseases  and  they  can  serve  as  diagnostic  and  prognostic                 markers. That’s why the sensitive, simple, fast and cost-effective detection method is required.                  1. INTRODUCTION                 Small  RNA  molecules  are  effective  regulators  of  gene  expression,  and  the  expression                signature  of  one  subgroup  of  small  RNA,  the  miRNAs,  has  been  linked  to  disease                 development  and  progression.  The  abnormal  expression  of  specific  miRNAs  is  associated                with many diseases including cancer and/or diabetes [1, 2]. Effect of miRNAs is based on                 binding  to  the  untranslated  region  (3’UTR)  of  target  mRNA  and  causing  degradation  (or                 inhibition) of target mRNA and their effects are involved in many cellular processes such as                proliferation,  differentiation,  apoptosis,  metastases,  angiogenesis,  and  immune  response  [3,                 4].  Therefore,  detection  of  miRNAs  in  biological  samples  will  greatly  improve  the                understanding of their functions and broaden effective tools for cellular process control and                 disease prevention. However there are several limitations of miRNAs detection such as their                short  length  and  tissue-specific  occurrence.  Basic  methods  used  to  detection  are  northern                                                               185","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  blotting,  real  time  RT-PCR,  ISH  (in  situ  hybridization)  and  micro-RNA  arrays  [5-12].  But                 these  methods  demand  labeling  amplification  and/or  enzymatic  reaction.  In  this  work  the                electrochemical detection based on specific magnetic separation was used because there is no                 need of labeling or amplification.                  2. MATERIAL AND METHODS                 The miR-124 (5´-UAA GGC ACG CGG UGA AUG CC-3´) and complementary biotinylated                oligonucleotide (ODN) anti-miR-124 (5´-Btn-GG CAT TCA CCG CGT GCC TTA-3´ were                 used for optimization of magnetic separation. For the binding specificity confirmation ODNs                at  the  following  sequences  were  used:  ODN  10  (ATGGCAGACA),  ODN  21                 (GCGATTGATGGTGATACGGTT),  ODN  55  (GGGGACAAGTTTGTACAAAAAAG                 CAGGCTGTGGCTAATACGAAAAAAACAACATT)  and  miR-150  (UAAGGCACG                CGGUGAAUGCCA).  The ODNs were synthesized by Sigma-Aldrich (USA).                 Electrochemical analysis                 Electrochemical  measurements  were  performed  with  AUTOLAB  PGS30  Analyzer                 (EcoChemie,  Netherlands)  connected  to  VA-Stand  663  (Metrohm,  Switzerland)  using  a                standard cell with three electrodes. A hanging mercury drop electrode (HMDE) with a drop                                2                area of 0.4 mm  was employees the working electrode. An Ag/AgCl/3M KCl electrode served                as the reference electrode. Pt electrode was used as the auxiliary electrode.                 Adsorptive transfer technique was used for the electrochemical determination of RNA. The                adsorptive transfer technique is based on the sample accumulation (120 s) onto the working                 electrode surface and consequently on the electrode washing and square wave voltammetric                (SWV) measurement. All  experiments  were carried out  at  room temperature (21°C). SWV                 measurements were carried out in the presence of acetate buffer pH 5.0. SWV parameters:                start  potential  0  V,  end  potential  -1.8  V,  potential  step  5  mV,  frequency  280  Hz,  and                 amplitude 25.05 mV. For smoothing and baseline correction the software GPES 4.9 supplied                 by EcoChemie was employed.                  3. RESULTS  AND  DISCUSSION                 For optimal MPs utilization the binding capacity of MPs surface was determined. To the MPs                the anti-miR-124 was added and after immobilization step and MPs separation the amount of                 unbound antisense ODN in retantate was measured. In the Fig. 1A the dependence of anti-                 miR-124  amount  remained  in  the  retentate  on  applied  concentration  to  MPs  is  shown.  In                                                             186","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    addition  of  3µM  probe  the  unbound  probe  amount  was  only  3.3%.  So  for  following                 experiments was 3µM anti-miR-124 added to 500 µg of MPs.                The next optimization step was the elution temperature determination (Fig. 1B). During the                 elution dsRNA denaturation occurs and the miR-124 is released into the elution solution. The                 goal was to find such a temperature at which would be released maximum miR-124 amount                and  simultaneously  that  does  not  cause  the  damage  of  streptavidin-biotin  binding.  For                 following  experiments  was  elution  temperature  of  70°C  was  used,  the  peak  height  was                349 nA and the SWV signal of blank was insignificant. The optimized method selectivity was                 proofed  using  oligonucleotides  of  different  lengths  and  miR-150  with  non-complementary                sequences (Fig. 1C). The oligonucleotides lengths were 10 nt (ODN 10), 21 nt (ODN 21) and                 55  nt  (ODN  55).  The  signals  of  non-complementary  sequences  were  at  the  same  level  as                 control  solutions.  To  determine  the  sensitivity  of  the  optimized  separation  method  a                calibration curve for the whole isolation process was performed (Fig. 1D).                         120                                     1200                                                                   C                      Unconnected anti-miR-124 (%)  80        Peak height (nA) 1000 0                       100                           A                                                                800                                                                600                        60                                                                400                                                                200                        40                        20                                                                             The nucleic acid type                        0                             3      4      5     6      7       700  ODN 10  ODN 21  ODN 55  miR-150  miR-124                        Applied anti-miR-124 concentration (μM) to 500 μg of MPs  D                        800                                     600  electrolyte 50.0 nM                                   eluted miR-124  blank            6.0 nM  100.0 nM                        700                           B                                    500  12.5 nM  200.0 nM                                                                          400.0 nM                                                                                       0.1 µA                        600                                     400  25.0 nM  -1.30  -1.35  -1.40  -1.45  -1.50                       Peak height (nA)  400                   Peak height (nA)  300  Potential (V) y = 1.1012x + 45.709                        500                        300                                                                200                        200                                                                100                      R² = 0.9811                        100                         0                                        0                              50    60     70    80     90         0       100     200     300     400                                    Elution temperature ( C)              Applied miR-124 concentration (nM)                    Figure 1.: (A) MPs binding capacity (anti-miR-124) optimization. The dependence of biotinylated anti-miR-                124 which was not bound to MPs on applied anti-miR-124 concentration.. (B) The peak height dependence of                eluted  miR-124  amount/the  eluate  without  miR-124  on  elution  temperature.  (C)  The  binding  specificity                 verification. The peak height dependence of the eluted target oligonucleotides on target nucleotide sequence. The                non-complenmentary ODNs were ODN 10, ODN 21, ODN 55, miR-150 and the complementary was miR-124.                (D) Dependence of the peak height on applied miR-124 concentration using the optimized MPs-based isolation.                Inset: the isolated miR-124 voltammograms.                                                              187","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  4. CONCLUSION                 The  miRNA  specific  separation  based  on  magnetic  microparticles  was  optimized.  The                developed electrochemical detection in connection with specific magnetic separation is label-                 free, simple and low-cost method for miRNA analysis.                  5. ACKNOWLEDGEMENT                The work has been supported by NanoBioTECell GA CR P102/11/1068.                   6. REFERENCES                [1] Karolina, D. S., Armugam, A., Tavintharan, S., Wong, M. T. K., et al., PLoS One 2011, 6.                [2] Ruan, Q. G., Wang, T., Kameswaran, V., Wei, Q., et al., Proc. Natl. Acad. Sci. U. S. A. 2011, 108, 12030-                12035.                 [3] Mirnezami, A. H. F., Pickard, K., Zhang, L., Primrose, J. N., Packham, G., Ejso 2009, 35, 339-347.                [4] Ruan, K., Fang, X., Ouyang, G., Cancer Letters 2009, 285, 116-126.                [5] Bernardo, B. C., Charchar, F. J., Lin, R. C. Y., McMullen, J. R., Heart Lung and Circulation 2012, 21, 131-                142.                [6] Li, W., Ruan, K. C., Analytical and Bioanalytical Chemistry 2009, 394, 1117-1124.                [7] Obernosterer, G., Martinez, J., Alenius, M., Nature Protocols 2007, 2, 1508-1514.                 [8] Pena, J. T. G., Sohn-Lee, C., Rouhanifard, S. H., Ludwig, J., et al., Nature Methods 2009, 6, 139-141.                [9] Schmittgen, T. D., Lee, E. J., Jiang, J. M., Sarkar, A., et al., Methods 2008, 44, 31-38.                [10] Streit, S., Michalski, C. W., Erkan, M., Kleeff, J., Friess, H., Nature Protocols 2009, 4, 37-43.                [11] Valoczi, A., Hornyik, C., Varga, N., Burgyan, J., et al., Nucleic Acids Research 2004, 32.                [12] Wang, X. W., Rna-a Publication of the Rna Society 2009, 15, 716-723.                                                                                188","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                      INTERACTION OF METALLOTHIONEIN WITH CDTE QUANTUM                                  DOTS STUDIED BY ELECTROCHEMISTRY                                          1,2                                                           1,2                                                                            1,2                                                                                              1,2                     Katerina TMEJOVA , David HYNEK , Pavel KOPEL , Vojtech ADAM , Rene                                                         KIZEK  1,2*                1                   Department of Chemistry and Biochemistry, Faculty of Agronomy, Mendel University in                   Brno, Zemedelska 1, 613 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                    3058/10, 616 00 Brno, Czech Republic                   *kizek@sci.muni.cz                 Abstract                 This study is focused on investigation of interaction of metallothionein with CdTe quantum                dots. Application  of  electrochemical  technique  for  such  interaction  monitoring  was  tested.                 Concretely using of differential pulse voltammetry Brdicka reaction was applied. Two new                voltammetric peaks X and Y were detected  with the prolonged time of interaction up to 6                 hours.                 1. INTRODUCTION                Metallothionein  (MT)  as  a  low-molecular  protein  with  mass  of  6–7  kDa  has  the  tertiary                 structure based on the presence of two domains. These domains readily form cysteine clusters                to  bind  metal  ions  [1].  The  main  functions  of  MT  consist  in  the  transport  of  metal  ions,                 accumulation of Zn, and detoxification of metals [1]. Due to high affinity of MT to heavy                 metals, its interaction with quantum dots (QDs) is also possible [2]. An increased expression                of MT after exposure of model organisms to Cd-based QDs was found in studies dealing with                 toxicity of QDs [3, 4]. Further, the biosynthesis of QDs in rats and earthworms exposed to                CdCl 2 was found [5, 6].                 2. MATERIAL AND METHODS                Chemicals                 All chemicals for preparation QDs were purchased from Sigma-Aldrich (USA) in ACS purity.                 CdTe QDs were done according to Skalickova et al. [7]. QDs were stored at 4 °C. MT was                isolated from rabbit liver according to Skalickova et al. [7].                 Electrochemical determination of metal ions                Electrochemical determination was carried out by differential pulse voltammetry (DPV) in the                 Brdicka  electrolyte  [8]  by  using  a  standard  cell  with  three  electrodes  and  cooled  sample                holder  and  measurement  cell  to  4  °C  (Julabo  F25,  JulaboDE).  A  hanging  mercury  drop                                                               189","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                2                electrode (HMDE) with a drop area of 0.4 mm  was the working electrode. An Ag/AgCl/3M                KCl electrode was the reference and platinum electrode was auxiliary.  Sample consisting of                10 µl 0.8 µM MT and 10 µl 500 µM QDs was pipetted into an electrochemical cell (2 ml) and                 then the electrolyte (1 980 µl) was added. The MT-QD interaction was studied for 0, 240,                480, 960 s, and 30, 60, 90 min, and 2, 3, 4, 5, 6 hours at 4°C. After that, monitoring of the                 interaction  was  performed  using  the  electrochemical  detection  (DPV).  More  details  about                electrochemical Brdicka experiments is shown in the paper Petrlova et al. [9].                   3. RESULTS  AND  DISCUSSION                The  interaction  of  QDs  with  MT  was  also  monitored  electrochemically  in  the  Brdicka                 electrolyte.  The  mixture  of 500  µM  QDs  and  0.6  µM  MT  was  left  to  interact  for  the                interaction time from 0 s to 6 h with MT. Five peaks were detected (X, Y, RS2Co, Cat1, Cat2)                 in  the  obtained  voltammograms.  However,  we  were  interested  in  peak  X  (potential                -0.90±0.05 V) and peak Y (potential -1.00±0.05 V) that appeared during the interaction.                                             Figure 1.: Interaction of CdTe with MT in time interval from 0 s to 6 h. Dependence of peak height and peak                potential on interaction time for peak X (A) and peak Y (B). Error bars were calculated by standard deviation,                n = 3.                 Increase of the peak X was very rapid (forty times in 120 min) and next slightly decreased.                 The potential was shifted significantly to positive values (from -0.99 to -0.91 V) and this shift                 mainly linear. Analogical situation was observed in the case of the peak Y, but changes in its                peak  height  were  not  so  distinct  (1.7x). With increasing  interaction  time  height  of  peak Y                 increased quite linearly opposite to the change of height of peak X. Changes in potentials of                                                              190","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    both peaks were linearly. On the other hand, Cat2 peak (data are not presented) decreased.                 The Cat2 peak corresponds to the presence of –SH moieties, and MT interacts with QDs via                these sulfhydryl moieties within its structure. During the interaction between MT and QDs,                 free -SH groups in MT are probably saturated by QDs and this effect causes observed increase                of height of the X and Y peaks as a proof of metal reduction in the complex MT-QD [9].                  4. CONCLUSION                 Complexes formed during interaction of QDs with MT were studied in our work by Brdicka                catalytic reaction, which providing new peaks X and Y associated with MT-QD complexes.                 These new peaks could bring new information about interaction of QDs with metalloproteins                because  application  of  QDs  in  organism  will  be  connected  with  question  of  various  QDs                 interactions.                  5. ACKNOWLEDGEMENT                 Financial support from CEITEC CZ.1.05/1.1.00/02.0068 is greatly acknowledged.                  6. REFERENCES                [1] Babula P, Masarik M, Adam V, et al., Metallomics, 4 (2012), 739-750.                 [2] Sharma S, Rais A, Sandhu R, et al., Int. J. Nanomed., 8 (2013), 1477-1488.                [3] Gagne F, Fortier M, Yu L, et al., J. Environ. Monitor., 12 (2010), 1556-1565.                [4] Lin C H, Yang M H, Chang L W, et al., Nanotoxicology, 5 (2011), 650-663.                [5] Sturzenbaum S R, Hockner M, Panneerselvam A, et al., Nature Nanotechnol., 8 (2013), 57-60.                [6] Trabelsi H, Azzouz I, Sakly M, et al., Int. J. Nanomed., 8 (2013), 1121-1128.                [7] Skalickova S, Zitka O, Nejdl L, et al., Chromatographia, 76 (2013), 345-353.                 [8] Heyrovsky M, Norrish R G W, Nature, 200 (1963), 880-881.                [9] Petrlova J, Potesil D, Mikelova R, et al., Electrochim. Acta, 51 (2006), 5112-5119.                                                                             191","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                              PHYSICAL CHEMISTRY OF INORGANIC-ORGANIC                                                 NANOSTRUCTURES                                                   Lubomir SPANHEL     1, 2*               1  CEITEC-Masaryk  University,  Faculty  of  Chemistry,  Kamenice  5,  625  00  Brno,  Czech                 Republic             2  Institute  of  Chemical  Sciences  Rennes  ICSR,  CNRS-UMR  6226,  Université  de  Rennes  1,                 France                          *lubomir.spanhel@ceitec.muni.cz, lspanhel@seznam.cz, spanhel@univ-rennes1.fr                   Abstract                Concentrated semiconductor and metal nanocolloids represent an ideal basis for fundamental                 photophysical chemistry research as well as for applied nanobiomaterials sciences. This talk                addresses the usefulness of various spectroscopic, electrochemical and calorimetric methods                 in nanoparticle research. The following four examples will be given:                    1)  Structure/optical spectral profile relationships, nucleation chaos and fractal law based                        electromagnetic resonance/cluster size correlation diagrams                     2)  Mechanistic aspects of MX nanocolloid growth (M = Zn, Cd;  X = O, S, Se, Te)                    3)  Multifunctionalisation of nanoparticle surfaces with foreigner atoms                     4)   Glass formation and confined salt melting in nanoparticulate ZnO fractals                  REFERENCES                 [1] L. Spanhel and M. Anderson, J. Am. Chem. Soc. 1990, 112, 2278 \"Synthesis of Porous Quantum Size CdS                      Membranes: Photoluminescence Phase Shift and Demodulation Measurements\";  J. Am. Chem. Soc. 1991,                      113, 2826 \"Semiconductor Clusters in the Sol-Gel-Process: Quantized Aggregation, Gelation and Crystal                     Growth in Concentrated ZnO Colloids\"                [2] V. Ptatschek, T. Schmidt, M. Lerch, G. Müller, L. Spanhel, A. Emmerling, J. Fricke, A.H. Foitzik and                       E. Langer, Ber. Bunsenges. Phys. Chem. 1998, 102, 85. ”Quantized Aggregation Phenomena in II-VI                      Semiconductor Colloids”                [3] C. Lorenz, A. Emmerling, J. Fricke, T. Schmidt, M. Hilgendorff, L. Spanhel, J. Non.-Cryst. Solids 1998,                      238, 1-5. “Aerogels containing strongly luminescing ZnO nanocrystals”                                                                                   III                [4] M. Kohls; M. Bonnani, L. Spanhel  Appl. Phys. Lett. 2002, 81, 3858. Green Er  luminescence in fractal                     ZnO Nanolattices”                [5] M Kohls, G. Müller, L. Spanhel, C. Le Luyer, J.C. Plenet, J. Mugnier, M. Giersig, Su, G. McMahon,                     Review in ”Low-Dimensional Systems: Theory, Preparation, and Some Applications, Kluwer Publishers,                                                                              III                                                                                 IV                     Eds. L.M. Liz-Marzan, M. Giersig, 2003, p. 107-120. ”Nanocrystalline Er /Si @ZnO Multilayers:                                                            192","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                         A Detailed Optical and Structural Study”                [6] L. Spanhel, Review in J. Sol-Gel Sci. \& Technol. 2006, 39, 7-24.                     “Colloidal ZnO Nanostructures and Functional Coatings: A Survey                [7] S. Toscani, O. Hernandez,  C. Aparicio, L. Spanhel, J. Sol-Gel Sci.\& Technol. 2014, 69, 457-463.                       “Glass formation and confined melting in nanoparticulate ZnO Aggregates”.                                                                                                      193","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                ELIMINATION SQUARE WAVE VOLTAMMETRY                                                                                                      1                                                                                 1                                                            1                     Libuse TRNKOVA    1,2* , Iveta PILAROVA , Rudolf NAVRATIL , Libor GURECKY ,                                                                     1                                                     Vimal SHARMA                1   Department of Chemistry, Faculty of Science, Masaryk University, Kamenice 5, CZ-625 00                   Brno, Czech Republic                2                     Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technická                   3058/10, CZ-616 00  Brno, Czech Republic                *libuse@chemi.muni.cz                   Abstract                In this contribution it is shown  that the elimination voltammetric procedure (EVP)  gives a                 new  dimension  for  the  data  evaluation  not  only  in  linear  sweep  (LSV)  or  cyclic  (CV)                voltammetry but also in square wave voltammetry (SWV).                   1. INTRODUCTION                Square wave voltammetry (SWV), originated from an idea of Barker and Gardner [1-2], is in                 fact a variant of pulse voltammetry [3]. In this technique the change of the potential of the                working electrode combines a large amplitude square wave and staircase modulation with the                 tuneable step (Fig.1A). The current is measured at the end of each potential half-cycle change,                right before the next, so that the contribution of the charging current to the current signal is                 minimized.  The  current  measured  on  the  backward  half-cycle  (I b)  is  subtracted  from  the                 current measured on the forward half-cycle (I f) and this difference is displayed as a function                of the applied potential (Fig.1B). The SWV maxima reflect the concentration dependency of                 electroactive species with the detection limits in the nanomolar range.                          A                                    B                                                    ΔI = I – I  b                                                     f                                                                                                        ¨                       Fig.1 Potential wave form for SWV (1A) and measured  SWV currents (1B).                                                              194","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    Various transformations of voltammetric data (semi derivative, semi integral, derivative and                 integral)  can  help  to  extract  the  specific  information  (number  of  transferred  electrons,                mechanism etc.) and can reveal details concerning the adsorption phenomena in the studied                 electrochemical  system.  Optionally,  the  recently  developed  transformation  based  on  the                elimination voltammetric procedure (EVP) can be used to remove chosen current components                 from the total voltammetric current (I tot). Consequently, the measured current on scan rate (v)                                                                    x                dependencies follow a power law relationship (I ~ v ) with the power law coefficient x that                should have a value of 0, 1 and 1/2  for the kinetic (I k), charging (I c) and diffusion (I d) current                 component, respectively. Using the power low and the reference scan rate every total current                can be expressed as:                                                   0         1         1 2                                                   I  v  I  v  I   v    I                                                              (1)                                      v                                       vref                                              v ref  k  v ref  c  v ref  d                The EVP function f(I) eliminating required current components is calculated from different                 total currents measured at different scan rates. This approach is frequently used in LSV or CV                 (linear sweep or cyclic voltammetric) measurements.                  2. MATERIAL AND METHODS                 All  electrochemical  experiments  were  performed  using  the  electrochemical  analyzer                µAUTOLAB TYPE III (Metrohm, Switzerland) connected with VA Stand 663 and controlled                 by  GPES  Manager  software.  The  sample  of  adenine  (Sigma-Aldrich)  was  dosed  into  the                 electrochemical  cell,  consisting  of  three  electrodes:  a  hanging  mercury  drop  electrode                                                           2                (HMDE) with  an  effective area of 0.3 mm   or a  pencil graphite electrode (PeGE) with  an                                          2                effective area of 15.9 mm  as the working electrodes, and Ag/AgCl/3M KCl and Pt wire as                the reference and auxiliary electrodes, respectively. The experimental conditions for  SWV:                          -4                                                             -1                c Ade = 2·10  M , frequency: 400, 200 and 100 s , accumulation time t a = 0 – 300 s, phosphate–                acetate buffer (pH 5.8); the potential  range  for  Ade  reduction on  a  mercury electrode  was                from 0 to -1.7 V and for Ade oxidation on PeGE was from -0.15 to 1.6 V. The SWV curves                 obtained  were  smoothed  by  using  the  Savitzky–Golay  filter,  level  2,  and  the  elimination                voltammetric procedure EVP according to (3).                   3. RESULTS AND DISCUSSION                The scan rate (v) is not adjustable parameter within the frame of SWV method but it can be                 calculated by knowing the modulation frequency f and the voltage step E step according to:                                                              195","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                        v  E step  f                                                                (2)                 With the same step and different frequency we can obtain the desired scan rate values. For the                                              v                integer  2,  when  the  value                                                         the  most  common  EVP  function  eliminating                                                            2                                                    2                                                      or                                                         1                                                          /                                             v                                              ref                I k+I c and conserving I d is expressed in the case of  LSV:                                              (f  ) I  11 . 657 I vref  /  2  17 . 485 I vref  . 5  8284 I 2 vref                      (3)                and in case of SWV:                                    ) I ( f  11 . 657 I  17 . 485 I    . 5  8284 I                                                  2  fref        fref          / 1  2  fref                        (4)                 The  verification  of  the  aforementioned  relationships  was  performed  using  known                electroactive substances on the mercury and the carbon electrodes.                  4. CONCLUSION                 The  integration  of  the  elimination  voltammetric  procedure  (EVP)  into  the  square  wave                voltammetry (SWV) measurements has shown to be governed by the scan rate – frequency                 dependence.                  5. ACKNOWLEDGMENTS                 The work has been supported by projects: (a) MUNI/A/0972/2013 and (b) KONTAKT II (LH                13050) of the Ministry of Education, Youth and Sports of the Czech Republic, (c) CEITEC –                 Central European Institute of Technology Project CZ.1.05/1.1.00/02.0068.                  6. REFERENCES                [1] G. C. Barker, A. W. Gardner, Z. Anal.Chem, 173 (1960) 79.                [2] L. Ramaley, M.S. Krause, Jr., Anal.Chem., 41 (1969) 1362.                [3] A. J. Bard, L. R. Faulkner, Electrochemical  Methods. Fundamentals and Applications, John Willey\&Sons,                          nd                      INC., (2  edition) 2000. p. 293.                [4] L. Trnkova (a) and F. Jelen, S. Hason, L. Trnkova (b) in: V. Adam and R. Kizek (Eds.); Utilizing of Bio-                       electrochemical and Mathematical Methods in Biological Rese-arch, Signpost, Kerala, India 2007, (a)                       Chapter  4, p. 51 and (b) Chapter 8, p. 153.                 [5] L. Trnkova, F. Jelen, M. Ozsoz in: M. Ozsoz (Ed.), Electrochemical DNA Biosensors, Pan Stanford                       Publishing, Singapore, 2012, Ch. 11, p. 355.                                                                  196","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                               DEVICE FOR DEHYDRATION MONITORING USING                       POTASSIUM CONCENTRATION IN URINE MEASUREMENT                                              1                                                                    1                                                                                         1*                                Jaromír ŽÁK , Petra MAJZLÍKOVÁ , Jaromír HUBÁLEK                1                   Department  of  Microelectronics, Faculty of  Electrical  Engineering  and Communication,                   Brno University of Technology, Technicka 3058/10, 616 00 Brno, Czech Republic                   *hubalek@feec.vutbr.cz                  Abstract                Real-time dehydration monitoring is one of the key methods for organism state determination                 especially for elderly people and sportsmen. Dehydration is a complex value and its precise                 automated determination is not a simple task. A lot of measurement methods can be used for                its  determination.  One  of  the  measurement  method  and  its  implementation  into  automated                 electronic acquisition system is described in this article.                  1. INTRODUCTION                One  of  the  possibilities  for  dehydration  measurement  is  its  determination  from  potassium                 concentration in urine [1]. This concentration is reciprocally proportional to total amount of                 water in the human body. Standard values vary between 100 mg/l and 2000 mg/l in the most                cases  [2].  The  concentration  can  be  measured  by  standard  ion-selective  sensor  [3]  and                 processed in any type of medical measurement device or data logger [4] and recalculated into                 organism  hydration  value.  This  value  will  be  probably  inexact  due  to  ordinary  potassium                concentration which depends e.g. on gender, age or condition of the tested person. Long term                 measurement has to be performed for basic potassium concentration value determination for                each measured person separately.                 More accurate results with faster measurement response can be achieved by combination of                multiple measurement methods not only by potassium concentration in urine measurement.                 The results can be acquired and evaluated automatically and sent to the physician in case of                 emergency state. The second big advantage of the automated measurement system is located                in the possibility of non-obtrusive real-time measurement in the real conditions.                                                                     197","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  2. EXPERIMENTS                    Potassium concentration has been measured by standard potassium ion-selective electrode                obtained from  Elektrochemické detektory s.r.o. (Trutnov,  Czech Republic) [3] with  simple                 voltage output setting. The voltage is converted into data value in the form of digital number                 by  standalone  wireless  battery  powered  electronic  circuit  after  each  measurement                (see figure 1).  Measured  data  are  collected  into  PC  database  where  they  can  be  viewed  or                 analyzed later. Additional values like personal information and other measurement results can                be measured automatically or inserted manually by user or physician.                                         Figure 1.: Design of the developed wireless device for automated potassium in urine concentration measurement                  After  the  measurement  platform  built-up,  calibration  of  the  system  was  performed.                Interference  of  the  other  urine  substances  had  been  expected  but  this  expectation  was                 disconfirmed  by  calibration  measurement.  No  interferences  were  observed  in  the  typical                potassium  concentration  range  [2].  The  interferences  were  registered  only  for  potassium                 concentrations below 10 mg/l (see figure 2a). KCl solutions (concentrations between 1 mg/l                 and 10 g/l) in Milli-Q water (Millipore, USA) with addition of synthetic urine (concentrations                from  0 %  to  2 % - typical  values)  has  been  used  for  basic  calibration  measurement.                 Ion-selective  electrode  had  been  conditioned  before  use  in  a  0.5  mmol/l  KCl  (PENTA,                Czech Republic) aqueous solution for 1 h.                                                                          198","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                       Figure  2.:  A)  Calibration  of  the  sensor  system  with  dependency  on  urine  addition  concentration  and                B) measured values in human urea                   Calibrated measurement system was tested in laboratory and later in real conditions. Other                 methods measurement results, water intake/outtake value and subjective feeling of the tested                persons  corresponded  with  dehydration  state  determined  by  automated  potassium  in  urine                 measurement (see figure 2b).                   3. CONCLUSION                The automated measurement of potassium concentration in urine by newly created system for                 real-time  data  acquisition  was  realized  for  dehydration  detection.  The  whole  system  was                created, calibrated and tested in the laboratory and real conditions. This system can be useful                 for many medical and sport branches in the future.                  4. ACKNOWLEDGEMENT                 This  work  has  been  supported  by  the  project  MAS  No.  120228  (7H10021)  supported                by ENIAC JU and the project SIX No. CZ.1.05/2.1.00/03.0072.                  5. REFERENCES                 [1]LE. Armstrong, et al., Int J Sport Nutr, vol. 8, pp. 345–355, 1998                [2]Putnam, D. F., NASA contractor report, 1971 Elektrochemické detektory s.r.o., [online]                <http://www.elektrochemicke-detektory.cz/iontove-selektivni-elektrody/>, 2014                 [3]Solovei, D., et al., Procedia Engineering, 2012. 47: p. 200-203                                                                 199","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                               SEMICONDUCTIVE SnO /MWCNTs GAS SENSOR                                                              2                                                                               1,2                                                                                                     1,2                                                       1,2                    Imrich GABLECH    1,2* , Jan PRASEK , Petra MAJZLIKOVA , Jaromir HUBALEK                1                   Brno  University  of Technology,  Faculty  of  Electrical  Engineering  and  Communications,                   Department of Microelectronics, Technicka 3058/10, 616 00 Brno, Czech Republic                2  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic                    *imrich.gablech@ceitec.vutbr.cz                 Abstract                The metal oxide semiconductive tin dioxide based gas sensor for detection of explosive gasses                 was designed and fabricated. There were prepared and compared two different types of active                layer materials – unmodified tin dioxide nanopowder and tin dioxide nanopowder modified                 with multiwalled carbon nanotubes (MWCNTs). We were able to detect 50 ppm of isobutane                with satisfactory sensitivity using the MWCNTs modified active layers.                   1. INTRODUCTION                Nowadays,  monitoring  of  dangerous  explosive  gasses  as  they  are  butane  or  methane  is                 needed. Therefore the reliable and sufficiently sensitive sensors for fast detection of very low                concentrations  are  developed.  Metal-oxide  semiconductive  gas  sensors  represent  one                 possibility for such requirements [1-3].                  2. SENSOR FABRICATION                 Heater fabrication and packaging                 Semiconductive  gas  sensors  usually  work  at  higher  temperatures  up  to  450  °C  [1-3].  The                appropriate heater element and package is therefore needed. One possibility for such solution                 is the usage of LTCC and thick-film technology in combination with TO-8 microelectronic                package.  The  fabricated  LTCC  frame  in  combination  with  TO-8  package  is  shown  in  the                 Figure 1.                           Figure 1.: The fabricated LTCC frame and its placement in TO-8 package                                                                200","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    The heating meander made of ESL 5545-G paste is placed from the bottom side of the LTCC                 frame  in  which  the  silicon  or  alumina  substrate  with  maximal  dimensions  8 × 8 mm                containing  electrodes  and  sensitive  layer  could  be  inserted.  This  substrate  is  then                 mechanically  fixed  to  LTCC  frame  using  Ferro  11-036  thick-film  paste.  The  conductive                interconnection from electrodes to the LTCC frame is made using wirebonding. The LTCC                 frame is fixed to TO-8 package using conductive thick-film AgPd based paste (see Figure 1).                  Active layer electrode substrate design and fabrication                 The active electrode substrate was designed to be made from 525 µm thick silicon / 475 nm                thick  silicon  dioxide  wafer  with  dimensions  of  8 × 8 mm.  On  the  silicone  substrate,  the                 interdigital structure in the area of 6 × 6 mm was designed. The fingers width was designed to                be 100 µm with a gap of 50 µm between them (see. fig. 2).                          Figure 2.: Interdigital structure design, its detail and fabricated gold active layer electrode substrate                 The  interdigital  structure  is  made  of  evaporated  100 nm  thick  titanium  layer  with  high                temperature resistance as the adhesive layer. The 250 nm thick gold layer was evaporated over                 it to form the wire-bondable and high electrically conductive electrodes.                  Sensitive layers preparation and deposition                 There were fabricated three types of active layers: one unmodified (SnO 2 – 100 wt%) and two                modified  with  multiwalled  carbon  nanotubes  (SnO 2/MWCNTs  –  1.5 wt%  and                 SnO 2/MWCNTs – 3.0 wt%). The layers were spray-coated on previously prepared active layer                 substrate from 1 ml suspension of nanopowder dispersed in dimethylformamide.                Then the active layer substrates were annealed at 450 °C in vacuum for 48 hours to make                 basic stabilization. Final stabilization was made in gas chamber at 350 °C. The stabilization                was finished after four hours under 500 sccm/min gas flow of synthetic air or 2500 ppm of                 isobutane in synthetic air mixture changing.                  3. RESULTS AND DISCUSSION                 All  sensors  were  characterized  at  350  °C  for  the  detection  of  isobutane  in  the  range  of                 concentration from 50 ppm to 4000 ppm in synthetic air. The resistance was stabilized within                                                            201","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  120 seconds after each isobutane concentration change. From the measured data, the plot of                 calibration curves was created (see Figure 3). From the results shown in figure 3 is clear that                the higher sensitivity of MWCNTs modified active layers was achieved.                                          Figure 3.: Calibration curves of all types of prepared active layers and the photo of fabricated sensor                   4. CONCLUSION                 The semiconductive tin dioxide based or tin dioxide with MWCNTs mixture based gas sensor                for detection of isobutane was designed and fabricated. From the obtained results is clear that                 the higher sensitivity was achieved using MWCNTs modified sensitive layers which allowed                detection of concentrations of isobutane from the levels of 50 ppm to 100 ppm in synthetic air.                 The  unmodified  sensor  showed  the  satisfying  sensitivity  of  8%  from  the  300 ppm  of                isobutane.  All  three  types  of  sensors  could  serve  as  the  sensor  of  in  time  detection  of                 explosive level of isobutane, because the explosive level of isobutane in air is in range from                 14000 to 83000 ppm. The selectivity of fabricated sensors to isobutane was not confirmed.                  5. ACKNOWLEDGEMENT                 The financial support from the projects SIX CZ.1.05/2.1.00/03.0072 and GAP205/10/1374 is                highly acknowledged.                  6. REFERENCES                 [1]Rembeza S I, Shamatova Y V, Svistova T V, et al.: Semiconductors, 46 (2012), 1190-1193                [2]Bakin A S, Bestaev M V, Dimitrov  D T, et al.: Thin Solid Films, 269 (1997), 168-171                [3]Quaranta F, Rella R, Siciliano P, et al.: Sensors and Actuators B: Chemical 58 (1999) 350-355                                                              202","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                            HIGH RESOLUTION TECHNICS                           FOR FABRICATION OF SPECIAL NANOELECTRODES                                                                    1,2                               Marian MÁRIK    *1,2 ,Vojtěch SVATOŠ , Jaromír HUBÁLEK     1,2                1  Central  European  Institute  of  Technology,  Brno  University  of  Technology,  Technicka                   3058/10, 616 00 Brno, Czech Republic, *marian.marik@ceitec.vutbr.cz                2   LabSensNano,  Department  of  Microelectronics,  Faculty  of  Electrical  Engineering  and                    Communication, Brno University of Technology, Technicka 3058/10, 616 00 Brno, Czech                    Republic                  Abstract                 In-vivo impedance measurements of cells are the objective of current scientific research in                 area of biological sciences. A problem that needs to be solved is how to measure extracellular                 potential without causing trauma or damage in living cells. One possible solution is based on                nanoelectrodes that are fabricated due to current high technology level. The main goal of this                 work is  to  design  and create nanoelectrode with pair of  gold  or platinum nanowires  using                standard  thin-film  techniques  (micro-  and  nanotechniques)  and  high  resolution  ion-  and                 electron beam methods.                  1. INTRODUCTION                 Design and preparation of novel nanoelectrode pair was realized. Nowadays the measurement                of electrical potential in living cells is a very trendy analysis in the sphere of biotechnology.                 The cells communicate with each other with the help of electric signals. Additionally based on                certain changes of the electrical potential it is possible to observe the reactions of living cells                 in their life cycles or reactions due to various external influences. The novel nanoelectrode                 pair has been fabricated for a short and also a long term extracellular potential measurement                in water based medium. [1, 2]                  2. MATERIAL AND METHODS                 The novel two nanoelectrode system was designed and simulated in software CoventorWare.                 Sensitivity of living cells to temperature changes is high. In nanoelectrodes the joule heating                 can increases the temperature of the sample or device as accompanying effect of large current                densities should be considered. To decrease the undesirable thermal shock the electrodes were                 designed to be thermal stable against the current flow. The thermal simulation for nanowires                                                              203","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                  was  provided  by  software  CoventorWare.  Amount  of  Joule  heating  was  confirmed  by                 calculations. [3, 4]                    Designed  two-electrode  electrochemical  system  operates  on  the  basis  of  impedance                 sensors. Low dimensions of electrodes require a combination of micro and nanotechnology                techniques for fabrication. For the base of chip a silicon wafer coated with thermal silicon                 oxide with a thickness 500 nm was used. Fabrication of base electrodes was realized by PVD                and lithograpy techniques. Gold was used as the base material for the electrode.                 The preparation of vertical nanoelectrodes was provided by high resolution techniques. The                 submicron  electrodes  and  the  mark  for  electron  beam  lithography  (EBL)  were  etched  into                gold  and  NiCr  layer  with  FIB.  The  vertical  electrodes  were  fabricated  by  electrochemical                 deposition of gold into the photoresist mask. The mask was prepared by e-beam lithography.                  3. RESULTS  AND  DISCUSSION                 The  vertical  nanoelectrode  system  for  a  long  term  measurement  was  realized  by                electrochemical  deposition  of  gold  and  for  short  term  measurement  was  realized  by  EBID                 platinum. Fabricated gold electrodes shape is similar to a cone. It was caused by EBL process                 when the nanoholes were little bit affected by proximity effect of electron beam. It could be                expected that this alteration of nanoelectrode shape would have no effect  on a function of                 electrodes.                                                Figure 1.: Details of submicron electrodes and the place, where vertical nanoelectrodes are deposited (left) and                vertical nanoelectrode on the edge of the horizontal submicron electrode (right).                                                               204","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                    4. CONCLUSION                    Novel vertical nanoelectrode system for extracellular potential measurement of cells was                designed and fabricated. In the first part of this work electrode system was designed and the                 thermal  influence  on  nanowires  was  simulated.  The  second  part  of  this  work  was  the                fabrication  of  the  electrode  system.  Electrode  system  for  a  long  term  measurement  was                 realized from gold and for short term measurement was realized from platinum. The sensor                testing will begin in near future on living cells.                  5. ACKNOWLEDGEMENT                This  work  has  been  performed  in  laboratories  supported  by  the  SIX  project                 CZ.1.05/2.1.00/03.0072  and  supported  by  Grant  Agency  of  the  Czech  Republic  under  the                 contract GACR P102/11/1068 NaNoBioTECell.                  6. REFERENCES                [1]FRADEN, J. (2004). Handbook of modern sensors: physics, designs, and applications, New York, Springer                 Verlag, ISBN 0-387-00750-4.                [2]CUI, Z. (2008). Nanofabrication: Principles, Capabilities and Limits, Didcot, UK, Springer, ISBN 978-0-387-                75576-2.                [3]ZOSKI, C. G. (2007). Handbook of electrochemistry, Elsevier, Oxford, ISBN 9780444519580.                [4]FANGOHR, H., CHERNYSHENKO, D. S., FRANCHIN, M., FISCHBACHER, T., MEIER, G. (2011)Joule                heating in nanowires, Physical Review B..                 [5]RAI-CHOUDHURY,  P.,  (1997).  Handbook  of  Microlithography,  Micromachining,  and  Microfabrication:                Microlithography, SPIE Press, ISBN 0819423-78-5.                                                                                             205","","","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                covní setkání fyzikálních chemiků a elektrochemiků                                                                                                                         208","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                        Sborník příspěvků                 XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                   Editor: Libuše Trnková                 Technická úprava Romana Ševčíková                 Vydala Masarykova univerzita, Brno                 Vydání první, 2014                    ISBN 978-80-210-6842-1                                                                  209","","XIV. Pracovní setkání fyzikálních chemiků a elektrochemiků                                  Brno 2014                                                                                                                        211"];